SPTSSA (NM_138288) Human Untagged Clone
CAT#: SC317216
SPTSSA (untagged)-Human chromosome 14 open reading frame 147 (C14orf147)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C14orf147; SSSPTA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317216 representing NM_138288.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGGGATGGCGCTGGCGCGGGCCTGGAAGCAGATGTCCTGGTTCTACTACCAGTACCTGCTGGTC ACGGCGCTCTACATGCTGGAGCCCTGGGAGCGGACGGTGTTCAATTCCATGCTGGTTTCCATTGTGGGG ATGGCACTATACACAGGATACGTCTTCATGCCCCAGCACATCATGGCGATATTGCACTACTTTGAAATC GTACAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_138288 |
| Insert Size | 216 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138288.3 |
| RefSeq Size | 2538 bp |
| RefSeq ORF | 216 bp |
| Locus ID | 171546 |
| UniProt ID | Q969W0 |
| Protein Families | Transmembrane |
| MW | 8.5 kDa |
| Gene Summary | Serine palmitoyltransferase (SPT; EC 2.3.1.50) catalyzes the first committed and rate-limiting step in sphingolipid biosynthesis. SSSPTA is a small SPT subunit that stimulates SPT activity and confers acyl-CoA preference to the SPT catalytic heterodimer of SPTLC1 (MIM 605712) and either SPTLC2 (MIM 605713) or SPTLC3 (MIM 611120) (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209747 | SPTSSA (Myc-DDK-tagged)-Human chromosome 14 open reading frame 147 (C14orf147) |
CNY 1200.00 |
|
| RC209747L3 | Lenti ORF clone of Human chromosome 14 open reading frame 147 (C14orf147), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC209747L4 | Lenti ORF clone of Human chromosome 14 open reading frame 147 (C14orf147), mGFP tagged |
CNY 3600.00 |
|
| RG209747 | SPTSSA (tGFP-tagged) - Human chromosome 14 open reading frame 147 (C14orf147) |
CNY 2800.00 |
|
| SC120477 | SPTSSA (untagged)-Human chromosome 14 open reading frame 147 (C14orf147) |
CNY 6200.00 |
