TMIE (NM_147196) Human Untagged Clone
CAT＃: SC317254
TMIE (untagged)-Human transmembrane inner ear (TMIE)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFNB6 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_147196 edited
ATGCTCGCTGACTACCCGTGGCCAAAGCCCGTGGCCACCGAGCGCCGGCTGGCAGGGGCA GTGACCGGCGGCCGGCCCGTTCGTCCCTGGGCTCCGCAAGCGGCGCGGTGGCACGAAGAT GGCGGGGTGGCCGGGCGCGGGTCCCCTCTGCGTGCTGGGCGGCGCCGCACTCGGGGTGTG CCTCGCGGGGGTTGCCGGGCAGCTGGTGGAGCCCAGCACGGCCCCACCCAAGCCCAAGCC GCCTCCGCTGACCAAGGAGACAGTGGTGTTCTGGGACATGCGCCTGTGGCACGTGGTGGG CATCTTTTCGCTCTTCGTGTTGTCCATCATCATCACGCTGTGCTGTGTCTTCAACTGTCG TGTGCCACGGACCCGGAAGGAGATCGAAGCCCGGTACCTGCAGCGAAAGGCAGCCAAGAT GTACACAGACAAGCTGGAGACTGTGCCACCCCTCAATGAGCTCACAGAAGTCCCAGGAGA GGATAAGAAGAAGAAGAAGAAGAAGAAGGACAGTGTGGACACAGTGGCCATCAAAGTAGA GGAGGATGAGAAGAATGAGGCCAAGAAGAAGAAAGGAGAGAAATGAAGACATCCTGGGCA GCTTGGGCTGGCGGGCCCTGGAGCTCAAGCCGTGGCCGGGGTCCAGGCATGTTGGACTCT GAGCTCATTTGGGGACCACAGAGGCTGTGGTCAGAGAGGGAAGCTGAGGCCCATGGCCAC ATCCTCATGGCCCATCAGGGGCAGGAACCAGACAATCTCGTAGGTGTCCTGCCCCCCAGC CTAGGCTTGGCTCCTTTCACCCCATCCACATGGGTACTGTCTCGGCAGAGGTGGTCTGGT GCCACCGTCCCTCTGCAGATACACTGCTCTCCCCACCCAGACCTGCCTGTCTCCCACCCT TTCTGCCAGGGATGGCAGTGGCTGTGAAGGAGTAATGGGATATGGGGTTACTTCAGCCAC CCTTTCTGGCACGAAATGGCTGAAGTG |
| Restriction Sites | Please inquire |
| ACCN | NM_147196 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to contain 3bp deletion compared with NM_147196.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_147196.2, NP_671729.2 |
| RefSeq Size | 1861 bp |
| RefSeq ORF | 471 bp |
| Locus ID | 259236 |
| UniProt ID | Q8NEW7 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a transmembrane inner ear protein. Studies in mouse suggest that this gene is required for normal postnatal maturation of sensory hair cells in the cochlea, including correct development of stereocilia bundles. This gene is one of multiple genes responsible for recessive non-syndromic deafness (DFNB), also known as autosomal recessive nonsyndromic hearing loss (ARNSHL), the most common form of congenitally acquired inherited hearing impairment. [provided by RefSeq, Mar 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220050 | TMIE (Myc-DDK-tagged)-Human transmembrane inner ear (TMIE) |
CNY 1200.00 |
|
| RC220050L1 | Lenti ORF clone of Human transmembrane inner ear (TMIE), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC220050L2 | Lenti ORF clone of Human transmembrane inner ear (TMIE), mGFP tagged |
CNY 5890.00 |
|
| RC220050L3 | Lenti ORF clone of Human transmembrane inner ear (TMIE), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC220050L4 | Lenti ORF clone of Human transmembrane inner ear (TMIE), mGFP tagged |
CNY 5890.00 |
|
| RG220050 | TMIE (tGFP-tagged) - Human transmembrane inner ear (TMIE) |
CNY 2800.00 |
|
| SC306309 | TMIE (untagged)-Human transmembrane inner ear (TMIE) |
CNY 3990.00 |
