DNAL1 (NM_031427) Human Untagged Clone
CAT#: SC317283
DNAL1 (untagged)-Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C14orf168; CILD16; LC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317283 representing NM_031427.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGAAAGCAACAACAATCAAAGAAGCCTTAGCGAGATGGGAAGAGAAAACTGGCCAGAGGCCATCT GAAGCCAAAGAGATAAAACTTTATGCCCAGATTCCCCCTATAGAGAAGATGGATGCATCCTTGTCCATG CTTGCTAATTGCGAGAAGCTTTCACTGTCTACAAACTGCATTGAAAAAATTGCCAACCTGAATGGCTTA AAAAACTTGAGGATATTATCTTTAGGAAGAAACAACATAAAGAACTTAAATGGACTGGAGGCAGTAGGG GACACATTAGAAGAACTGTGGATCTCCTACAATTTTATTGAGAAGTTGAAAGGGATCCACATAATGAAG AAATTGAAGATTCTCTACATGTCTAATAACCTGGTAAAAGACTGGGCTGAGTTTGTGAAGCTGGCAGAA CTGCCATGCCTCGAAGACCTGGTGTTTGTAGGCAATCCCTTGGAAGAGAAACATTCTGCTGAGAATAAC TGGATTGAAGAAGCAACCAAGAGAGTGCCCAAACTGAAAAAGCTGGATGGTACTCCAGTAATTAAAGGG GATGAGGAAGAAGACAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_031427 |
Insert Size | 573 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_031427.3 |
RefSeq Size | 8538 bp |
RefSeq ORF | 573 bp |
Locus ID | 83544 |
UniProt ID | Q4LDG9 |
Domains | LRR, LRR_SD22 |
Protein Pathways | Huntington's disease |
MW | 21.5 kDa |
Gene Summary | This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202768 | DNAL1 (Myc-DDK-tagged)-Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1 |
CNY 1200.00 |
|
RC202768L3 | Lenti ORF clone of Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC202768L4 | Lenti ORF clone of Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG202768 | DNAL1 (tGFP-tagged) - Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1 |
CNY 2800.00 |
|
SC111453 | DNAL1 (untagged)-Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1 |
CNY 1200.00 |
|
SC320816 | DNAL1 (untagged)-Human dynein, axonemal, light chain 1 (DNAL1), transcript variant 1 |
CNY 1200.00 |