DIRAS2 (NM_017594) Human Untagged Clone
CAT#: SC317295
DIRAS2 (untagged)-Human DIRAS family, GTP-binding RAS-like 2 (DIRAS2)
CNY 3990.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Di-Ras2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317295 representing NM_017594.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTGAGCAGAGTAACGATTACCGGGTGGCCGTGTTTGGGGCTGGCGGTGTTGGCAAGAGCTCCCTG GTGTTGAGGTTTGTGAAAGGCACATTCCGGGAGAGCTACATCCCGACGGTGGAAGACACCTACCGGCAA GTGATCAGCTGTGACAAGAGCATATGCACATTGCAGATCACCGACACGACGGGGAGCCACCAGTTCCCG GCCATGCAGCGGCTGTCCATCTCCAAAGGGCACGCCTTCATCCTGGTGTACTCCATTACCAGCCGACAG TCCTTGGAGGAGCTCAAGCCCATCTACGAACAAATCTGCGAGATCAAAGGGGACGTGGAGAGCATCCCC ATCATGCTGGTGGGGAACAAGTGTGATGAGAGCCCCAGCCGCGAGGTGCAGAGCAGCGAGGCGGAGGCC TTGGCCCGCACATGGAAGTGTGCCTTCATGGAGACCTCAGCCAAGCTCAACCATAACGTGAAGGAGCTT TTCCAGGAGCTGCTCAACCTGGAGAAGCGCAGGACCGTGAGTCTCCAGATCGACGGGAAAAAGAGCAAG CAGCAGAAAAGGAAAGAGAAGCTCAAAGGCAAGTGCGTGATCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_017594 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_017594.4 |
| RefSeq Size | 4386 bp |
| RefSeq ORF | 600 bp |
| Locus ID | 54769 |
| UniProt ID | Q96HU8 |
| Domains | ras, RAS, RHO, RAB |
| MW | 22.5 kDa |
| Gene Summary | DIRAS2 belongs to a distinct branch of the functionally diverse Ras (see HRAS; MIM 190020) superfamily of monomeric GTPases.[supplied by OMIM, Apr 2004] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
RAS-related GTPases DIRAS1 and DIRAS2 induce autophagic cancer cell death and are required for autophagy in murine ovarian cancer cells
,null,
Autophagy
,PubMed ID 29368982
[DIRAS2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200740 | DIRAS2 (Myc-DDK-tagged)-Human DIRAS family, GTP-binding RAS-like 2 (DIRAS2) |
CNY 2400.00 |
|
| RC200740L3 | Lenti ORF clone of Human DIRAS family, GTP-binding RAS-like 2 (DIRAS2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC200740L4 | Lenti ORF clone of Human DIRAS family, GTP-binding RAS-like 2 (DIRAS2), mGFP tagged |
CNY 5890.00 |
|
| RG200740 | DIRAS2 (tGFP-tagged) - Human DIRAS family, GTP-binding RAS-like 2 (DIRAS2) |
CNY 4000.00 |
|
| SC114084 | DIRAS2 (untagged)-Human DIRAS family, GTP-binding RAS-like 2 (DIRAS2) |
CNY 9368.00 |
