CHMP4A (NM_014169) Human Untagged Clone
CAT#: SC317381
CHMP4A (untagged)-Human chromatin modifying protein 4A (CHMP4A)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C14orf123; CHMP4; CHMP4B; HSPC134; SHAX2; SNF7; SNF7-1; VPS32-1; VPS32A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317381 representing NM_014169.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGCGGCGGCGCCCTGAGGACGGATTGGGCAAGGCTGGTCCCTGTGTGATGAGACATCACCCTCCC AGGAGCAAGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGT CTCGGCAGGCTCTTCGGGAAGGGGAAGAAGGAGAAAGGGCCAACCCCTGAAGAAGCAATACAGAAACTG AAGGAGACAGAGAAGATACTGATCAAGAAACAGGAATTTTTGGAGCAGAAGATTCAACAGGAGCTACAA ACAGCCAAGAAGTATGGGACCAAGAATAAGAGAGCTGCCCTACAGGCTTTGCGGAGGAAGAAAAGATTC GAACAGCAGCTGGCACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAAT GCCACTACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCCCAAAGCATGAAGAAGGCCTACCAG GACATGGACATTGACAAGGTAGATGAACTGATGACTGACATCACGGAACAACAGGAGGTGGCCCAGCAG ATCTCAGATGCCATTTCTCGGCCTATGGGCTTTGGAGATGATGTGGATGAGGATGAACTGCTGGAGGAG CTAGAGGAGCTGGAGCAGGAGGAATTGGCCCAGGAGTTGTTAAATGTGGGCGACAAGGAAGAAGAACCC TCAGTCAAATTGCCTAGTGTACCTTCTACTCATCTGCCGGCAGGGCCAGCTCCCAAAGTGGATGAAGAT GAAGAAGCACTAAAGCAGTTGGCTGAGTGGGTATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_014169 |
| Insert Size | 798 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014169.3 |
| RefSeq Size | 1372 bp |
| RefSeq ORF | 798 bp |
| Locus ID | 29082 |
| UniProt ID | Q9BY43 |
| Domains | DUF279 |
| Protein Pathways | Endocytosis |
| MW | 29.8 kDa |
| Gene Summary | CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222002 | CHMP4A (Myc-DDK-tagged)-Human chromatin modifying protein 4A (CHMP4A) |
CNY 2400.00 |
|
| RC222002L1 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC222002L2 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), mGFP tagged |
CNY 5890.00 |
|
| RC222002L3 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC222002L4 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), mGFP tagged |
CNY 5890.00 |
|
| RG222002 | CHMP4A (tGFP-tagged) - Human chromatin modifying protein 4A (CHMP4A) |
CNY 4000.00 |
|
| SC115119 | CHMP4A (untagged)-Human chromatin modifying protein 4A (CHMP4A) |
CNY 2400.00 |
