FAM105B (OTULIN) (NM_138348) Human Untagged Clone
CAT#: SC317556
FAM105B (untagged)-Human family with sequence similarity 105, member B (FAM105B)
CNY 5488.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AIPDS; FAM105B; GUM |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317556 representing NM_138348.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTCGGGGGACTATGCCCCAGCCCGAAGCGTGGCCAGGCGCGAGCTGCGCCGAGACGCCGGCGCGG GAGGCGGCGGCCACGGCGCGGGACGGCGGGAAGGCGGCGGCCAGCGGGCAGCCGCGGCCCGAGATGCAG TGCCCGGCCGAGCATGAGGAGGACATGTACCGTGCTGCAGATGAAATAGAAAAGGAGAAAGAATTGCTT ATACATGAAAGAGGGGCATCAGAACCGAGATTAAGCGTAGCTCCTGAAATGGATATCATGGACTACTGC AAAAAAGAATGGAGAGGAAATACACAGAAAGCAACGTGTATGAAAATGGGCTATGAAGAGGTTTCTCAG AAGTTCACCTCCATACGGCGAGTCCGTGGTGATAATTACTGTGCACTGAGGGCCACGCTGTTCCAGGCC ATGAGCCAGGCTGTGGGGCTGCCGCCCTGGCTGCAGGACCCGGAGCTCATGCTGTTACCAGAAAAACTC ATAAGCAAATACAACTGGATCAAGCAATGGAAACTTGGACTGAAATTTGATGGGAAGAATGAGGACCTG GTTGATAAAATTAAAGAGTCCCTTACTCTGCTGAGGAAGAAGTGGGCAGGCTTGGCTGAAATGAGAACT GCTGAAGCAAGACAGATAGCTTGTGATGAACTATTCACAAATGAGGCGGAGGAATATAGCCTCTATGAA GCTGTAAAATTTCTAATGCTAAACAGAGCCATTGAACTATATAATGATAAAGAGAAAGGAAAGGAAGTA CCATTTTTCTCTGTGCTTCTGTTTGCTCGGGACACATCAAATGACCCAGGACAGCTTCTGAGGAACCAC CTCAACCAGGTGGGACACACTGGTGGTCTTGAACAGGTTGAAATGTTCCTTCTTGCCTATGCTGTGCGC CACACCATCCAGGTGTACCGGCTCTCCAAGTACAACACGGAAGAATTCATCACAGTCTACCCCACCGAC CCACCCAAGGACTGGCCAGTGGTAACGCTCATTGCTGAGGACGATCGGCACTATAACATCCCCGTCAGA GTGTGTGAGGAGACCAGTCTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_138348 |
| Insert Size | 1059 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138348.4 |
| RefSeq Size | 7896 bp |
| RefSeq ORF | 1059 bp |
| Locus ID | 90268 |
| UniProt ID | Q96BN8 |
| MW | 40.3 kDa |
| Gene Summary | This gene encodes a member of the peptidase C65 family of ubiquitin isopeptidases. Members of this family remove ubiquitin from proteins. The encoded enzyme specifically recognizes and removes M1(Met1)-linked, or linear, ubiquitin chains from protein substrates. Linear ubiquitin chains are known to regulate the NF-kappa B signaling pathway in the context of immunity and inflammation. Mutations in this gene cause a potentially fatal autoinflammatory syndrome in human patients. [provided by RefSeq, Sep 2016] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Deubiquitination of proteasome subunits by OTULIN regulates type I IFN production
,null,
Science Advances
,PubMed ID 34797715
[OTULIN]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224840 | FAM105B (Myc-DDK-tagged)-Human family with sequence similarity 105, member B (FAM105B) |
CNY 5488.00 |
|
| RC224840L1 | Lenti ORF clone of Human family with sequence similarity 105, member B (FAM105B), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC224840L2 | Lenti ORF clone of Human family with sequence similarity 105, member B (FAM105B), mGFP tagged |
CNY 5890.00 |
|
| RC224840L3 | Lenti ORF clone of Human family with sequence similarity 105, member B (FAM105B), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224840L4 | Lenti ORF clone of Human family with sequence similarity 105, member B (FAM105B), mGFP tagged |
CNY 7888.00 |
|
| RG224840 | FAM105B (tGFP-tagged) - Human family with sequence similarity 105, member B (FAM105B) |
CNY 7088.00 |
|
| SC100495 | FAM105B (untagged)-Human family with sequence similarity 105, member B (FAM105B) |
CNY 26064.00 |
其它FAM105B产品
