Neuronal calcium binding protein (NECAB3) (NM_031231) Human Untagged Clone

CAT#: SC317580

NECAB3 (untagged)-Human N-terminal EF-hand calcium binding protein 3 (NECAB3), transcript variant 1



  "NM_031231" in other vectors (5)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-NECAB3 antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APBA2BP; dJ63M2.4; dJ63M2.5; EFCBP3; NIP1; STIP3; SYTIP2; XB51
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317580 representing NM_031231.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTGCGCGGGGCTGCTCACCGTGTGCCTGCTCCGGCCGCCCGCGCCCCAGCCCCAGCCCCAGACC
CCGCGGCACCCCCAGCTCGCGCCCGACCCGGGGCCCGCCGGACACACGCTCTTCCAGGACGTTTTCCGC
AGAGCAGACAAGAATGATGATGGGAAGCTCTCATTTGAGGAATTCCAGAATTACTTTGCCGATGGGGTT
CTCAGCCTGGGGGAGCTGCAGGAACTGTTCAGCGGCATTGATGGGCATCTCACCGACAATTTAGAAACA
GAAAAACTGTGTGACTACTTCTCAGAGCACCTGGGTGTCTACCGGCCGGTGCTGGCTGCATTGGAATCG
CTGAACCGTGCAGTGCTCGCTGCCATGGATGCCACCAAGCTGGAGTACGAGAGGGCCTCCAAAGTGGAC
CAGTTTGTGACGCGCTTCCTGCTGCGGGAGACGGTGAGCCAGCTGCAAGCCCTTCAGAGCTCGCTGGAG
GGGGCGTCAGATACCCTGGAGGCCCAGGCCCATGGCTGGCGGTCAGATGCAGAGAGCGTGGAGGCGCAG
AGCAGGCTCTGCGGCAGCCGGCGGGCAGGACGCCGAGCCCTGAGGAGTGTCAGCCGGTCATCCACCTGG
TCCCCCGGCTCTTCTGACACAGGGCGCAGCTCAGAGGCCGAGATGCAGTGGCGGCTCCAGGTGAACCGC
CTCCAGGAGCTCATCGACCAGCTCGAGTGCAAGGCCCCCCGGCTGGAACCCCTGCGTGAAGAGGACCTG
GCCAAGGGGCCTGACTTGCACATCCTCATGGCCCAGAGGCAGGTCCAGGTGGCAGAGGAAGGCCTGCAG
GACTTCCACCGAGCCCTGCGCTGCTATGTGGACTTCACAGGGGCCCAGAGCCATTGTCTGCATGTGTCC
GCCCAGAAGATGCTGGACGGTGCCTCCTTCACCCTGTATGAGTTCTGGCAGGATGAGGCCTCCTGGAGA
AGGCACCAGCAGTCGCCTGGCAGCAAGGCCTTCCAGCGCATCCTCATCGACCACCTGCGGGCCCCGGAC
ACCCTCACCACTGTGTTCTTCCCAGCCTCCTGGTGGATAATGAATAACAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_031231
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_031231.3
RefSeq Size 1961 bp
RefSeq ORF 1089 bp
Locus ID 63941
UniProt ID Q96P71
Domains EFh
MW 40.8 kDa
Gene Summary The protein encoded by this gene interacts with the amino-terminal domain of the neuron-specific X11-like protein (X11L), inhibits the association of X11L with amyloid precursor protein through a non-competitive mechanism, and abolishes the suppression of beta-amyloid production by X11L. This protein, together with X11L, may play an important role in the regulatory system of amyloid precursor protein metabolism and beta-amyloid generation. The protein is phosphorylated by NIMA-related expressed kinase 2, and localizes to the Golgi apparatus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as XB51beta, lacks an alternate in-frame segment compared to variant 2. The resulting isoform (1) is shorter compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Neuronal calcium binding protein产品

Customer Reviews 
Loading...