NLK (NM_016231) Human Untagged Clone

CAT#: SC317895

NLK (untagged)-Human nemo-like kinase (NLK)



  "NM_016231" in other vectors (9)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal antibody to NLK (nemo-like kinase)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317895 representing NM_016231.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCTTTGTGGCGCAAGAGCCAACGCAAAAATGATGGCGGCTTACAATGGCGGTACATCTGCAGCA
GCAGCAGGTCACCACCACCACCATCACCACCACCTTCCACACCTCCCTCCTCCTCACCTGCACCACCAC
CACCACCCTCAACACCATCTTCATCCGGGGTCGGCTGCCGCTGTACACCCTGTACAGCAGCACACCTCT
TCGGCAGCTGCGGCAGCCGCAGCAGCGGCTGCAGCTGCAGCCATGTTAAACCCTGGGCAACAACAGCCA
TATTTCCCATCACCGGCACCGGGGCAGGCTCCTGGACCAGCTGCAGCAGCCCCAGCTCAGGTACAGGCT
GCCGCAGCTGCTACAGTTAAGGCGCACCATCATCAGCACTCGCATCATCCACAGCAGCAGCTGGATATT
GAGCCGGATAGACCTATTGGATATGGAGCCTTTGGTGTTGTCTGGTCAGTAACAGATCCAAGAGATGGA
AAGAGAGTAGCGCTCAAAAAGATGCCCAACGTCTTCCAGAATCTGGTCTCTTGCAAAAGGGTCTTCCGG
GAATTGAAGATGTTGTGTTTTTTTAAGCATGATAATGTACTCTCTGCCCTTGACATACTCCAACCTCCA
CACATTGACTATTTTGAAGAAATATATGTTGTCACAGAATTGATGCAGAGTGACCTACATAAAATTATC
GTCTCTCCTCAACCACTCAGCTCAGATCATGTCAAAGTTTTTCTTTATCAGATTTTGCGAGGTTTGAAA
TATCTCCATTCAGCTGGCATTTTACATCGAGACATTAAGCCAGGGAATCTCCTTGTGAACAGCAACTGT
GTTCTAAAGATTTGTGATTTTGGATTGGCCAGAGTGGAAGAATTAGATGAATCCCGTCATATGACTCAG
GAAGTTGTTACTCAGTATTATCGGGCTCCAGAAATCCTGATGGGCAGCCGTCATTACAGCAATGCTATT
GACATCTGGTCTGTGGGATGTATCTTTGCAGAACTACTAGGACGAAGAATATTGTTTCAGGCACAGAGT
CCCATTCAGCAGTTGGATTTGATCACGGATCTGTTGGGCACACCATCACTGGAAGCAATGAGGACAGCT
TGTGAAGGCGCTAAGGCACATATACTCAGGGGTCCTCATAAACAGCCATCTCTTCCTGTACTCTATACC
CTGTCTAGCCAGGCTACACATGAAGCTGTTCATCTCCTTTGCAGGATGTTGGTCTTTGATCCATCCAAA
AGAATATCCGCTAAGGATGCCTTAGCCCACCCCTACCTAGATGAAGGGCGACTACGATATCACACATGT
ATGTGTAAATGTTGCTTTTCCACCTCCACTGGAAGAGTTTATACCAGTGACTTTGAGCCTGTCACCAAT
CCCAAATTTGATGACACTTTCGAGAAGAACCTCAGTTCTGTCCGACAGGTTAAAGAAATTATTCATCAG
TTCATTTTGGAACAGCAGAAAGGAAACAGAGTGCCTCTCTGCATCAACCCTCAGTCTGCTGCTTTTAAG
AGCTTTATTAGTTCCACTGTTGCTCAGCCATCTGAGATGCCCCCATCTCCTCTGGTGTGGGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016231
Insert Size 1584 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016231.4
RefSeq Size 3555 bp
RefSeq ORF 1584 bp
Locus ID 51701
UniProt ID Q9UBE8
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase, Transcription Factors
Protein Pathways Adherens junction, MAPK signaling pathway, Wnt signaling pathway
MW 58.3 kDa
Gene Summary Serine/threonine-protein kinase that regulates a number of transcription factors with key roles in cell fate determination. Positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Activation of this pathway causes binding to and phosphorylation of the histone methyltransferase SETDB1. The NLK-SETDB1 complex subsequently interacts with PPARG, leading to methylation of PPARG target promoters at histone H3K9 and transcriptional silencing. The resulting loss of PPARG target gene transcription inhibits adipogenesis and promotes osteoblastogenesis in mesenchymal stem cells (MSCs). Negative regulator of the canonical Wnt/beta-catenin signaling pathway. Binds to and phosphorylates TCF7L2/TCF4 and LEF1, promoting the dissociation of the TCF7L2/LEF1/beta-catenin complex from DNA, as well as the ubiquitination and subsequent proteolysis of LEF1. Together these effects inhibit the transcriptional activation of canonical Wnt/beta-catenin target genes. Negative regulator of the Notch signaling pathway. Binds to and phosphorylates NOTCH1, thereby preventing the formation of a transcriptionally active ternary complex of NOTCH1, RBPJ/RBPSUH and MAML1. Negative regulator of the MYB family of transcription factors. Phosphorylation of MYB leads to its subsequent proteolysis while phosphorylation of MYBL1 and MYBL2 inhibits their interaction with the coactivator CREBBP. Other transcription factors may also be inhibited by direct phosphorylation of CREBBP itself. Acts downstream of IL6 and MAP3K7/TAK1 to phosphorylate STAT3, which is in turn required for activation of NLK by MAP3K7/TAK1. Upon IL1B stimulus, cooperates with ATF5 to activate the transactivation activity of C/EBP subfamily members. Phosphorylates ATF5 but also stabilizes ATF5 protein levels in a kinase-independent manner (PubMed:25512613).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...