RUNX2 (NM_001024630) Human Untagged Clone
CAT#: SC318014
RUNX2 (untagged)-Human runt-related transcription factor 2 (RUNX2), transcript variant 1
CNY 6592.00
Cited in 1 publication. |
Product images

CNY 1999.00
CNY 3600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AML3; CBF-alpha-1; CBFA1; CCD; CCD1; CLCD; OSF-2; OSF2; PEA2aA; PEBP2aA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001024630 edited
GCGATCGCCATGCTTCATTCGCCTCACAAACAACCACAGAACCACAAGTGCGGTGCAAAC TTTCTCCAGGAGGACAGCAAGAAGTCTCTGGTTTTTAAATGGTTAATCTCCGCAGGTCAC TACCAGCCACCGAGACCAACAGAGTCATTTAAGGCTGCAAGCAGTATTTACAACAGAGGG TACAAGTTCTATCTGAAAAAAAAAGGAGGGACTATGGCATCAAACAGCCTCTTCAGCACA GTGACACCATGTCAGCAAAACTTCTTTTGGGATCCGAGCACCAGCCGGCGCTTCAGCCCC CCCTCCAGCAGCCTGCAGCCCGGCAAAATGAGCGACGTGAGCCCGGTGGTGGCTGCGCAA CAGCAGCAGCAACAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAGCAGCAG CAGCAGGAGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGCAGCTGCA GTGCCCCGGTTGCGGCCGCCCCACGACAACCGCACCATGGTGGAGATCATCGCCGACCAC CCGGCCGAACTCGTCCGCACCGACAGCCCCAACTTCCTGTGCTCGGTGCTGCCCTCGCAC TGGCGCTGCAACAAGACCCTGCCCGTGGCCTTCAAGGTGGTAGCCCTCGGAGAGGTACCA GATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGG AATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGC CGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAA GTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGG CACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTA GGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCC CTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGG CAGGCACAGTCTTCCCCGCCGTGGTCCTATGACCAGTCTTACCCCTCCTACCTGAGCCAG ATGACGTCCCCGTCCATCCACTCTACCACCCCGCTGTCTTCCACACGGGGCACTGGGCTT CCTGCCATCACCGATGTGCCTAGGCGCATTTCAGATGATGACACTGCCACCTCTGACTTC TGCCTCTGGCCTTCCACTCTCAGTAAGAAGAGCCAGGCAGGTGCTTCAGAACTGGGCCCT TTTTCAGACCCCAGGCAGTTCCCAAGCATTTCATCCCTCACTGAGAGCCGCTTCTCCAAC CCACGAATGCACTATCCAGCCACCTTTACTTACACCCCGCCAGTCACCTCAGGCATGTCC CTCGGTATGTCCGCCACCACTCACTACCACACCTACCTGCCACCACCCTACCCCGGCTCT TCCCAAAGCCAGAGTGGACCCTTCCAGACCAGCAGCACTCCATATCTCTACTATGGCACT TCGTCAGGATCCTATCAGTTTCCCATGGTGCCGGGGGGAGACCGGTCTCCTTCCAGAATG CTTCCGCCATGCACCACCACCTCGAATGGCAGCACGCTATTAAATCCAAATTTGCCTAAC CAGAATGATGGTGTTGACGCTGATGGAAGCCACAGCAGTTCCCCAACTGTTTTGAATTCT AGTGGCAGAATGGATGAATCTGTTTGGCGACCATATTGATCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_001024630 |
Insert Size | 1800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001024630.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024630.2, NP_001019801.2 |
RefSeq Size | 5572 bp |
RefSeq ORF | 1770 bp |
Locus ID | 860 |
UniProt ID | Q13950 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) encodes the longest isoform (a, also known as OSF2/CBFA1a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. There are no full-length transcripts supporting this RefSeq in human; however, it is represented based on PMID: 9434946, and full-length transcript support from the mouse homolog (GeneID: 12393, AF010284.1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Novel RUNX2 frameshift mutations in Chinese patients with cleidocranial dysplasia.
,null,
European journal of oral sciences
,PubMed ID 23659235
[RUNX2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212884 | RUNX2 (Myc-DDK-tagged)-Human runt-related transcription factor 2 (RUNX2), transcript variant 1 |
CNY 6576.00 |
|
RC212884L1 | Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, Myc-DDK-tagged |
CNY 8976.00 |
|
RC212884L2 | Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, mGFP tagged |
CNY 8976.00 |
|
RC212884L3 | Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, Myc-DDK-tagged |
CNY 8976.00 |
|
RC212884L4 | Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, mGFP tagged |
CNY 8976.00 |
|
RG212884 | RUNX2 (tGFP-tagged) - Human runt-related transcription factor 2 (RUNX2), transcript variant 1 |
CNY 8176.00 |
|
SC302270 | RUNX2 (untagged)-Human runt-related transcription factor 2 (RUNX2), transcript variant 1 |
CNY 18664.00 |