IGF1 (NM_001111283) Human Untagged Clone
CAT#: SC318781
IGF1 (untagged)-Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IGF; IGF-I; IGFI; MGF |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001111283 edited
ATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTG AAGGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTC ACCTTCACCAGCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGAT GCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGC TCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGT GATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCT GTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACC AACAAGAACACGAAGTCTCAGAGAAGGAAAGGAAGTACATTTGAAGAACGCAAGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001111283 |
Insert Size | 4300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001111283.1, NP_001104753.1 |
RefSeq Size | 7370 bp |
RefSeq ORF | 477 bp |
Locus ID | 3479 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Dilated cardiomyopathy, Focal adhesion, Glioma, Hypertrophic cardiomyopathy (HCM), Long-term depression, Melanoma, mTOR signaling pathway, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer |
Gene Summary | The protein encoded by this gene is similar to insulin in function and structure and is a member of a family of proteins involved in mediating growth and development. The encoded protein is processed from a precursor, bound by a specific receptor, and secreted. Defects in this gene are a cause of insulin-like growth factor I deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). This isoform is also known as IC. Sequence Note: This RefSeq was created from transcript and genomic sequence because transcript sequence consistent with the reference assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Up-Regulation of MicroRNA-190b Plays a Role for Decreased IGF-1 That Induces Insulin Resistance in Human Hepatocellular Carcinoma
,Hung, TM;Ho, CM;Liu, YC;Lee, JL;Liao, YR;Wu, YM;,
PLOS ONE, Feb 2014.
[IGF1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225144 | IGF1 (Myc-DDK-tagged)-Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1 |
CNY 1,200.00 |
|
RC225144L1 | Lenti ORF clone of Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC225144L2 | Lenti ORF clone of Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC225144L3 | Lenti ORF clone of Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225144L4 | Lenti ORF clone of Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG225144 | IGF1 (tGFP-tagged) - Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 1 |
CNY 2,800.00 |