MAD2L1 binding protein (MAD2L1BP) (NM_014628) Human Untagged Clone
CAT#: SC319109
MAD2L1BP (untagged)-Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2
CNY 2400.00
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CMT2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014628.2
GTCGTGATGGCGGCGCCGGAGGCGGAGGTTCTGTCCTCAGCCGCAGTCCCTGATTTGGAG
TGGTATGAGAAGTCCGAAGAAACTCACGCCTCCCAGATAGAACTACTTGAGACAAGCTCT ACGCAGGAACCTCTCAACGCTTCGGAGGCCTTTTGCCCAAGAGACTGCATGGTACCAGTG GTGTTTCCTGGGCCTGTGAGCCAGGAAGGCTGCTGTCAGTTTACTTGTGAACTTCTAAAG CATATCATGTATCAACGCCAGCAGCTCCCTCTGCCCTATGAACAGCTTAAGCACTTTTAC CGAAAACCTTCTCCCCAGGCAGAGGAGATGCTGAAGAAGAAACCTCGGGCCACCACTGAG GTGAGCAGCAGGAAATGCCAACAAGCCCTGGCAGAACTGGAGAGTGTCCTCAGCCACCTG GAGGACTTCTTTGCACGGACACTAGTACCGCGAGTGCTGATTCTCCTTGGGGGCAATGCC CTAAGCCCCAAGGAGTTCTATGAACTCGACTTGTCTCTGCTGGCCCCCTACAGCGTGGAC CAGAGCCTGAGCACAGCAGCTTGTTTGCGCCGTCTCTTCCGAGCCATATTCATGGCTGAT GCCTTTAGCGAGCTTCAGGCTCCTCCACTCATGGGCACCGTCGTCATGGCACAGGGACAC CGCAACTGTGGAGAAGATTGGTTTCGACCCAAGCTCAACTATCGAGTGCCCAGCCGGGGC CATAAACTGACTGTGACCCTGTCATGTGGCAGACCTTCCATCCGAACCACGGCTTGGGAA GACTACATTTGGTTCCAGGCACCAGTGACATTTAAAGGCTTCCGCGAGTGAATGAGTGCT TCTTAATCCTAAAAACACAATGGCTGAATTATCTTTCTCCATGTGGCGCTGAATCACCCA TCTGGTTTGGAGCTAGAGTTGCTTCCTGGTGAGAGAGGAAGCAACTCTCCTTCTGGTTGT CTGCCTCCCCTCAGATTTCCTGATAGGCTGATGGCATGTGGCTGTGACTGTGACTGTAAT CATTGCTGAACAACATCTCTTTGAATCAAAGGTTGATTTTCCCAGAGGGTGCTGGGTCAG GCATTTCTATTAGGAGTTGGAAAGCAAAAATGGGTCCATAGACACTCTATGGAGGTGTCC CTTTCTGCTCTTTGCTGTGTCCTTTCAGAATTTTTACCAGGAACATAATGTGGATGTGAC TTATGAACTTAAATATAAAATAAATAGATTCTTATTATAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014628 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014628.2, NP_055443.1 |
RefSeq Size | 1283 bp |
RefSeq ORF | 825 bp |
Locus ID | 9587 |
UniProt ID | Q15013 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene was identified as a binding protein of the MAD2 mitotic arrest deficient-like 1 (MAD2/MAD2L1). MAD2 is a key component of the spindle checkpoint that delays the onset of anaphase until all the kinetochores are attached to the spindle. This protein may interact with the spindle checkpoint and coordinate cell cycle events in late mitosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant differs in the 5' region compared to variant 1, which includes a part of the coding sequence. The resulting isoform (2) has a distinct and shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202640 | MAD2L1BP (Myc-DDK-tagged)-Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2 |
CNY 2400.00 |
|
RC202640L1 | Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC202640L2 | Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC202640L3 | Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC202640L4 | Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, mGFP tagged |
CNY 4800.00 |
|
RG202640 | MAD2L1BP (tGFP-tagged) - Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2 |
CNY 4000.00 |
其它MAD2L1 binding protein产品