Clathrin light chain (CLTB) (NM_001834) Human Untagged Clone
CAT#: SC319160
CLTB (untagged)-Human clathrin, light chain B (CLTB), transcript variant 1
CNY 2400.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LCB |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001834.2
GAAGTGCGGTCCGCGCCAAGCCCGTCCCCGCCGACGCCGGCTCCCCGCGGCTCGGGTGAC
AGCGTCGCGGCCGCCGGACGCAGCGCGGGGCAGGCGCGGGCAGAGCCGAGCGCAGCGGAG GCTCCGGCGGAGGCGCGGGGAAAATGGCTGATGACTTTGGCTTCTTCTCGTCGTCGGAGA GCGGTGCCCCGGAGGCGGCGGAGGAGGACCCGGCGGCCGCCTTCCTGGCCCAGCAGGAGA GCGAGATTGCAGGCATAGAGAACGACGAGGGCTTCGGGGCACCTGCCGGCAGCCATGCGG CCCCCGCGCAGCCGGGCCCCACGAGTGGGGCTGGTTCTGAGGACATGGGGACCACAGTCA ATGGAGATGTGTTTCAGGAGGCCAACGGTCCTGCTGATGGCTACGCAGCCATTGCCCAGG CTGACAGGCTGACCCAGGAGCCTGAGAGCATCCGCAAGTGGCGAGAGGAGCAGAGGAAAC GGCTGCAAGAGCTGGATGCTGCATCTAAGGTCACGGAACAGGAATGGCGGGAGAAGGCCA AGAAGGACCTGGAGGAGTGGAACCAGCGCCAGAGTGAACAAGTAGAGAAGAACAAGATCA ACAACCGGGCATCCGAGGAGGCTTTCGTGAAGGAATCCAAGGAGGAGACCCCAGGCACAG AGTGGGAGAAGGTGGCCCAGCTATGTGACTTCAACCCCAAGAGCAGCAAGCAGTGCAAAG ATGTGTCCCGCCTGCGCTCGGTGCTCATGTCCCTGAAGCAGACGCCACTGTCCCGCTAGG TGCCTGCTAGGTGCATGGCCACAGAGCATGGGCTGGGCCTGGGCACAGGAGGAGCAGCTG CTTTGGTCGGGGTGGAGACTCGCAGCAGCTGCTACCCACAGCCTATTCCACTCCTCCCCA TCTCCAGGCGCTGGGAGGGGGGCCCTCACCCCGTCACGCCTCGCTCCCTCCTGGCCCTCT GGTCCAGCCCCTCACGCCTCCTCTCAGTCTACTCAATTGTGACTGTCCCTCCTGATGTAT TTTTTTTCTTGGCTTAAAGGGTGTGTTGTTGACTCTTTTTACACTTATTTATTATCATTC TCACTTCTCTGGAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001834 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001834.2, NP_001825.1 |
| RefSeq Size | 1130 bp |
| RefSeq ORF | 636 bp |
| Locus ID | 1212 |
| UniProt ID | P09497 |
| Domains | Clathrin_lg_ch |
| Protein Pathways | Endocytosis, Huntington's disease, Lysosome |
| Gene Summary | Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) lacks an alternate in-frame exon compared to variant 2, resulting in a shorter isoform (a) compared to isoform b. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
,null,
Nature methods
,PubMed ID 23524392
[CLTB]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202954 | CLTB (Myc-DDK-tagged)-Human clathrin, light chain B (CLTB), transcript variant 1 |
CNY 2400.00 |
|
| RC202954L1 | Lenti ORF clone of Human clathrin, light chain B (CLTB), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC202954L2 | Lenti ORF clone of Human clathrin, light chain B (CLTB), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC202954L3 | Lenti ORF clone of Human clathrin, light chain B (CLTB), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC202954L4 | Lenti ORF clone of Human clathrin, light chain B (CLTB), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG202954 | CLTB (tGFP-tagged) - Human clathrin, light chain B (CLTB), transcript variant 1 |
CNY 4000.00 |
其它Clathrin light chain产品
