BCCIP (NM_078468) Human Untagged Clone
CAT#: SC319236
BCCIP (untagged)-Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant B
CNY 2,400.00
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 6,281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TOK-1; TOK1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_078468.1
GGGGGTGAGCGGCAACATGGCGTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCC
GCAGCCGCCGGATCCCCCAGTCCAGCGCGACGAGGAAGAGGAAAAAGAAGTCGAAAATGA GGATGAAGACGATGATGACAGTGACAAGGAAAAGGATGAAGAGGACGAGGTCATTGACGA GGAAGTGAATATTGAATTTGAAGCTTATTCCCTATCAGATAATGATTATGACGGAATTAA GAAATTACTGCAGCAGCTTTTTCTAAAGGCTCCTGTGAACACTGCAGAACTAACAGATCT CTTAATTCAACAGAACCATATTGGGAGTGTGATTAAGCAAACGGATGTTTCAGAAGACAG CAATGATGATATGGATGAAGATGAGGTTTTTGGTTTCATAAGCCTTTTAAATTTAACTGA AAGAAAGGGTACCCAGTGTGTTGAACAAATTCAAGAGTTGGTTCTACGCTTCTGTGAGAA GAACTGTGAAAAGAGCATGGTTGAACAGCTGGACAAGTTTTTAAATGACACCACCAAGCC TGTGGGCCTTCTCCTAAGTGAAAGATTCATTAATGTCCCTCCACAGATCGCTCTGCCCAT GTACCAGCAGCTTCAGAAAGAACTGGCGGGGGCACACAGAACCAATAAGCCATGTGGGAA GTGCTACTTTTACCTTCTGATTAGTAAGACATTTGTGGAAGCAGAAAAAAACAATTCCAA AAAGAAACCTAGCAACAAAAAGAAAGCTGCGTTAATGTTTGCAAATGCAGAGGAAGAATT TTTCTATGAGAAGGCAATTCTCAAGTTCAACTACTCAGTGCAGGAGGAGAGCGACACTTG TCTGGGAGGCAAATGGTCTTTTGATGACGTACCAATGACGCCCTTGCGAACTGTGATGTT AATTCCAGGCGACAAGATGAACGAAATCATGGATAAACTGAAAGAATATCTATCTGTCTA ACCCATTTCCAATGGACAGTGATGGGCTTGTTTTTGTAAAATTACCAGAAAACTCAGTGG AGATTTACTGAAAAACTCAGACTTTATTCAGATTAAGTTCCTCTACAAAAAGTAGGGTTC TGTCCCATGTGTCTCTGACACATTTACAAAATACCAGTTTTTTAAAATTTTGGTCAAATT ATGAGTGGTTGATTTAAAAACTTTTCCAAGAAGAAGAAAAGCATGGAGTCGTAATTTAAA GAACTCAATAAAAACTTCTATTTTTTATTTTAAAATAATACCAAAAAAAAAAAAAAAAAA AAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_078468 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_078468.1, NP_510868.1 |
RefSeq Size | 1268 bp |
RefSeq ORF | 945 bp |
Locus ID | 56647 |
UniProt ID | Q9P287 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Gene Summary | This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (B) is alternatively spliced at the 3' end compared to transcript variant A. It encodes an isoform (BCCIPbeta) which has the same 258 N-terminal aa, but a different C-terminus compared to isoform BCCIPalpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203061 | BCCIP (Myc-DDK-tagged)-Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant B |
CNY 2,400.00 |
|
RC203061L3 | Lenti ORF clone of Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant B, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203061L4 | Lenti ORF clone of Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant B, mGFP tagged |
CNY 5,890.00 |
|
RG203061 | BCCIP (tGFP-tagged) - Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant B |
CNY 4,000.00 |