MED8 (NM_201542) Human Untagged Clone
CAT#: SC319302
MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 1
CNY 4936.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARC32 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_201542.2
GGCACGAGGCAGCCGCCTCGGCCGCCGCAATGCAGCCCTCCTTTCTATGTGTCATACTCG
TTTATCTGGGTGACCAACCTGTTCCTATTGGTGCAGAGAGAGGAGAAGCAGCTTGAGGCA TCATTAGATGCACTGCTGAGTCAAGTGGCTGATCTGAAGAACTCTCTGGGGAGTTTCATT TGCAAGTTGGAGAACGAGTATGGCCGGCTGACCTGCTTTGCCTTGCTTTCTGGACAGCTG AACACTCTGAACAAGGTCTTGAAGCATGAAAAAACACCGCTGTTCCGTAACCAGGTCATC ATTCCTCTGGTGTTGTCTCCAGACCGAGATGAAGATCTCATGCGGCAGACTGAAGGACGG GTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGAACCAAGCCTGACCCTGAA GTGGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGCATTGGTGCAGATGCAGCC CAGAAGCAGATCCAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAA GAGGAGCGAGAATCAGAGAGTGGAGGTCTCCGGCCGAACAAGCAGACCTTTAACCCTACA GACACTAATGCCTTGGTGGCAGCTGTTGCCTTTGGGAAAGGACTATCTAATTGGAGACCT TCAGGCAGCAGTGGTCCTGGCCAGGCAGGCCAGCCAGGAGCTGGGACGATCCTTGCAGGA ACCTCAGGATTACAGCAGGTGCAGATGGCAGGAGCTCCAAGCCAGCAGCAGCCAATGCTC AGTGGGGTACAAATGGCTCAGGCAGGTCAACCAGGGAAAATGCCAAGTGGAATAAAAACC AACATCAAGTCGGCTTCCATGCATCCCTACCAGCGGTGAGTGTGGCTGGCAACCTCGACT CCCTGGTGCTCTTTGCAGAGTTGGGCAGTGAAATTACCTTTTGCTCAAGGCTCACCTAGA TGGGTACAATAAAAAGAACATGGGCTTTCAGCAGCAGACAAATCCCACTTCCACCACTGA CTAGCTGTGTGACCTTGGACAAGTGACCTAATTTTTCTGAGCCTGTTTCTCATTTGTAAA TGGTGATAATACCTACCTCATAGGGTTGTTGTGAGGATTAAAATGAGGAAATGAATGTAA AGCACTTAGTACAGTATATGAAATAATGGGTATTCAATAAATGATAGTTTCTACAAAAAA AAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_201542 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_201542.2, NP_963836.1 |
| RefSeq Size | 2038 bp |
| RefSeq ORF | 1989 bp |
| Locus ID | 112950 |
| UniProt ID | Q96G25 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | This gene encodes a protein component of the mediator complex, which aids in transcriptional activation through interaction with RNA polymerase II and gene-specific transcription factors. The encoded protein may also function in ubiquitin ligation and protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (5) uses an alternate exon structure in the 3' coding region and differs in the 3' UTR, compared to variant 3. The resulting isoform (4) has a shorter C-terminus, compared to isoform 3. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204026 | MED8 (Myc-DDK-tagged)-Human mediator complex subunit 8 (MED8), transcript variant 1 |
CNY 2400.00 |
|
| RC204026L3 | Lenti ORF clone of Human mediator complex subunit 8 (MED8), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204026L4 | Lenti ORF clone of Human mediator complex subunit 8 (MED8), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG204026 | MED8 (tGFP-tagged) - Human mediator complex subunit 8 (MED8), transcript variant 1 |
CNY 4000.00 |
|
| SC317389 | MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 1 |
CNY 6270.00 |

