ATF5 (NM_012068) Human Untagged Clone

CAT#: SC319384

ATF5 (untagged)-Human activating transcription factor 5 (ATF5), transcript variant 1



  "NM_012068" in other vectors (6)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
ATF5 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATFX; HMFN0395
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_012068.2 CCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGTAGCCCCGGCC
ATGGCTCTGTAGCCTCGACCCCTTTGTGCCCCCGGCCCGTCTCCGCGCTCACCACGCCTG
CGCTCTCCGCTCCCACCTTCTTTCTTCAGCCGAGGCCGCCGCCGCCTCTCCTTGCTGCAG
CCATGGAGTCTTCCACTTTCGCCTTGGTGCCTGTCTTCGCCCACCTGAGCATCCTCCAGA
GCCTCGTGCCAGCTGCTGGTGCAGCCTCTCCTGTTGCCATCAGTGCCCAGCACCTGTGCT
ACAGCCATGTCACTCCTGGCGACCCTGGGGCTGGAGCTGGACAGGGCCCTGCTCCCAGCT
AGTGGGCTGGGATGGCTCGTAGACTATGGGAAACTCCCCCCGGCCCCTGCCCCCCTGGCT
CCCTATGAGGTCCTTGGGGGAGCCCTGGAGGGCGGGCTTCCAGTGGGGGGAGAGCCCCTG
GCAGGTGATGGCTTCTCTGACTGGATGACTGAGCGAGTTGATTTCACAGCTCTCCTCCCT
CTGGAGCCTCCCCTACCCCCCGGCACCCTCCCCCAACCTTCCCCAACCCCACCTGACCTG
GAAGCTATGGCCTCCCTCCTCAAGAAGGAGCTGGAACAGATGGAAGACTTCTTCCTAGAT
GCCCCGCTCCTCCCACCACCCTCCCCGCCGCCACTACCACCACCACCACTACCACCAGCC
CCCTCCCTCCCCCTGTCCCTCCCCTCCTTTGACCTCCCCCAGCCCCCTGTCTTGGATACT
CTGGACTTGCTGGCCATCTACTGCCGCAACGAGGCCGGGCAGGAGGAAGTGGGGATGCCG
CCTCTGCCCCCGCCACAGCAGCCCCCTCCTCCTTCTCCACCTCAACCTTCTCGCCTGGCC
CCCTACCCACATCCTGCCACCACCCGAGGGGACCGCAAGCAAAAGAAGAGAGACCAGAAC
AAGTCGGCGGCTCTGAGGTACCGCCAGCGGAAGCGGGCAGAGGGTGAGGCCCTGGAGGGC
GAGTGCCAGGGGCTGGAGGCACGGAATCGCGAGCTGAAGGAACGGGCAGAGTCCGTGGAG
CGCGAGATCCAGTACGTCAAGGACCTGCTCATCGAGGTTTACAAGGCCCGGAGCCAGAGG
ACCCGTAGCTGCTAGAAGGGCAGGGGTGTGGCTTCTGGGGGCTGGTCTTCAGCTCTGGCG
CCTTCATCCCCCTGCCTCTACCTTCATTCCAAACCCCTCTCGGCCGGGTGCAGTGGCTTA
TGCTTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGAGGATCGTTTGAGGCCAGGAGGT
CAATACCAGCCTGGGCAACATAGTAAGACCCTGTCTCTATTAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_012068
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012068.2, NP_036200.2
RefSeq Size 2010 bp
RefSeq ORF 849 bp
Locus ID 22809
UniProt ID Q9Y2D1
Domains BRLZ
Protein Families Transcription Factors
Gene Summary Transcription factor that either stimulates or represses gene transcription through binding of different DNA regulatory elements such as cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3'), ATF5-specific response element (ARE) (consensus: 5'-C[CT]TCT[CT]CCTT[AT]-3') but also the amino acid response element (AARE), present in many viral and cellular promoters. Critically involved, often in a cell type-dependent manner, in cell survival, proliferation, and differentiation (PubMed:10373550, PubMed:15358120, PubMed:21212266, PubMed:20654631). Its transcriptional activity is enhanced by CCND3 and slightly inhibited by CDK4 (PubMed:15358120). Important regulator of the cerebral cortex formation, functions in cerebral cortical neuroprogenitor cells to maintain proliferation and to block differentiation into neurons. Must be down-regulated in order for such cells to exit the cycle and differentiate (By similarity). Participates in the pathways by which SHH promotes cerebellar granule neuron progenitor cells proliferation (By similarity). Critical for survival of mature olfactory sensory neurons (OSN), directs expression of OSN-specific genes (By similarity). May be involved in osteogenic differentiation (PubMed:22442021). Promotes cell proliferation and survival by inducing the expression of EGR1 sinergistically with ELK1. Once acetylated by EP300, binds to ARE sequences on target genes promoters, such as BCL2 and EGR1 (PubMed:21791614). Plays an anti-apoptotic role through the transcriptional regulation of BCL2, this function seems to be cell type-dependent (By similarity). Cooperates with NR1I3/CAR in the transcriptional activation of CYP2B6 in liver (PubMed:18332083). In hepatic cells, represses CRE-dependent transcription and inhibits proliferation by blocking at G2/M phase (PubMed:22528486, PubMed:18701499). May act as a negative regulator of IL1B transduction pathway in liver (PubMed:24379400). Upon IL1B stimulus, cooperates with NLK to activate the transactivation activity of C/EBP subfamily members (PubMed:25512613). Besides its function of transcription factor, acts as a cofactor of CEBPB to activate CEBPA and promote adipocyte differentiation (PubMed:24216764). Regulates centrosome dynamics in a cell-cycle- and centriole-age-dependent manner. Forms 9-foci symmetrical ring scaffold around the mother centriole to control centrosome function and the interaction between centrioles and pericentriolar material (PubMed:26213385).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...