Monoacylglycerol Lipase (MGLL) (NM_001003794) Human Untagged Clone
CAT#: SC319504
MGLL (untagged)-Human monoglyceride lipase (MGLL), transcript variant 2
CNY 6270.00
Cited in 1 publication. |
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HU-K5; HUK5; MAGL; MGL |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001003794, the custom clone sequence may differ by one or more nucleotides
ATGCCAGAGGAAAGTTCCCCCAGGCGGACCCCGCAGAGCATTCCCTACCAGGACCTCCCTCACCTGGTCA ATGCAGACGGACAGTACCTCTTCTGCAGGTACTGGAAACCCACAGGCACACCCAAGGCCCTCATCTTTGT GTCCCATGGAGCCGGAGAGCACAGTGGCCGCTATGAAGAGCTGGCTCGGATGCTGATGGGGCTGGACCTG CTGGTGTTCGCCCACGACCATGTTGGCCACGGACAGAGCGAAGGGGAGAGGATGGTAGTGTCTGACTTCC ACGTTTTCGTCAGGGATGTGTTGCAGCATGTGGATTCCATGCAGAAAGACTACCCTGGGCTTCCTGTCTT CCTTCTGGGCCACTCCATGGGAGGCGCCATCGCCATCCTCACGGCCGCAGAGAGGCCGGGCCACTTCGCC GGCATGGTACTCATTTCGCCTCTGGTTCTTGCCAATCCTGAATCTGCAACAACTTTCAAGGTCCTTGCTG CGAAAGTGCTCAACCTTGTGCTGCCAAACTTGTCCCTCGGGCCCATCGACTCCAGCGTGCTCTCTCGGAA TAAGACAGAGGTCGACATTTATAACTCAGACCCCCTGATCTGCCGGGCAGGGCTGAAGGTGTGCTTCGGC ATCCAACTGCTGAATGCCGTCTCACGGGTGGAGCGCGCCCTCCCCAAGCTGACTGTGCCCTTCCTGCTGC TCCAGGGCTCTGCCGATCGCCTATGTGACAGCAAAGGGGCCTACCTGCTCATGGAGTTAGCCAAGAGCCA GGACAAGACTCTCAAGATTTATGAAGGTGCCTACCATGTTCTCCACAAGGAGCTTCCTGAAGTCACCAAC TCCGTCTTCCATGAAATAAACATGTGGGTCTCTCAAAGGACAGCCACGGCAGGAACTGCGTCCCCACCCT GA |
Restriction Sites | EcoRI-XhoI |
ACCN | NM_001003794 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001003794.1, NP_001003794.1 |
RefSeq Size | 4192 bp |
RefSeq ORF | 912 bp |
Locus ID | 11343 |
UniProt ID | Q99685 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Glycerolipid metabolism, Metabolic pathways |
Gene Summary | This gene encodes a serine hydrolase of the AB hydrolase superfamily that catalyzes the conversion of monoacylglycerides to free fatty acids and glycerol. The encoded protein plays a critical role in several physiological processes including pain and nociperception through hydrolysis of the endocannabinoid 2-arachidonoylglycerol. Expression of this gene may play a role in cancer tumorigenesis and metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Mutation of Cys242 of Human Monoacylglycerol Lipase Disrupts Balanced Hydrolysis of 1- and 2-monoacylglycerols and Selectively Impairs Inhibitor Potency
,Laitinen, T;Navia-Paldanius, D;Rytilahti, R;Marjamaa, JJ;Karizkova, J;Parkkari, T;Pantsar, T;Poso, A;Laitinen, JT;Savinainen, JR;,
Mol. Pharmacol. Dec 2013.
,PubMed ID 24368842
[MGLL]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202412 | MGLL (Myc-DDK-tagged)-Human monoglyceride lipase (MGLL), transcript variant 2 |
CNY 3600.00 |
|
RC202412L1 | Lenti-ORF clone of MGLL (Myc-DDK-tagged)-Human monoglyceride lipase (MGLL), transcript variant 2 |
CNY 6000.00 |
|
RC202412L2 | Lenti-ORF clone of MGLL (mGFP-tagged)-Human monoglyceride lipase (MGLL), transcript variant 2 |
CNY 5890.00 |
|
RC202412L3 | Lenti-ORF clone of MGLL (Myc-DDK-tagged)-Human monoglyceride lipase (MGLL), transcript variant 2 |
CNY 5890.00 |
|
RC202412L4 | Lenti-ORF clone of MGLL (mGFP-tagged)-Human monoglyceride lipase (MGLL), transcript variant 2 |
CNY 5890.00 |
|
RG202412 | MGLL (tGFP-tagged) - Human monoglyceride lipase (MGLL), transcript variant 2 |
CNY 5200.00 |
其它Monoacylglycerol Lipase产品