Podoplanin (PDPN) (NM_198389) Human Untagged Clone
CAT#: SC319523
PDPN (untagged)-Human podoplanin (PDPN), transcript variant 2
CNY 2400.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AGGRUS; GP36; Gp38; GP40; HT1A-1; OTS8; PA2.26; T1A; T1A-2; T1A2; TI1A |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_198389.2
GATAAATGCTGACTCCGCTCGGAAAGTTCTCAACTGCAAAGTTTGCTGTCCGGCTGCCTA
GGGTCTGGGAAGCTCGGGCACCCTCCCTCTCCGGGGCTCCTGCTCCCACCCCTCCGGCCC CCCCACCGTCGCGCTCCTCCAGGCTGGGCCTGTGGCCGCGGTGCTTTTTAATTTTCCCCC AGCTCAGAATCTTGCTGCTCGGCCCCCAGGAGAGCAACAACTCAACGGGAACGATGTGGA AGGTGTCAGCTCTGCTCTTCGTTTTGGGAAGCGCGTCGCTCTGGGTCCTGGCAGAAGGAG CCAGCACAGGCCAGCCAGAAGATGACACTGAGACTACAGGTTTGGAAGGCGGCGTTGCCA TGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTG GCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATC TGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCAA ACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGA AAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCG GCTTCATTGGTGGAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGTACTCGCCCT AAAGAGCTGAAGGGTTACGCCCTGCTGCCAACGTGCTTAAAAAAAGACCGTTTCTGACTC TGTGCCCTGTCCCTGAGCTCGTGGGAGAAGATGACCCGTGGAACACTTGCCTGGCCCACT CAGAATCCACGGTGACCTCTCCGCTTGCCAAAATAACCGAAGGAAAGACCGTTCACCAGA CTTGGCTCCTCTAAACATTTGCTGTTCAAACATGTTTTTGAATATACATTCTATAAAAGA TTATTTGAAAGACAAAATTCATAGAAAATGGAGCAAAACTGTATAAACTGATTTGTAACT AACACTGGACCATTGGATCGATATTATATGCTGTAACCATGAAAAAAAAAAAAAAAAAAA A |
| Restriction Sites | Please inquire |
| ACCN | NM_198389 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198389.2, NP_938203.2 |
| RefSeq Size | 2822 bp |
| RefSeq ORF | 711 bp |
| Locus ID | 10630 |
| UniProt ID | Q86YL7 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined but it has been proposed as a marker of lung injury. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Up-Regulation of the Lymphatic Marker Podoplanin, a Mucin-Type Transmembrane Glycoprotein, in Human Squamous Cell Carcinomas and Germ Cell Tumors
,Vivien Schacht, Soheil S. Dadras, Louise A. Johnson, David G. Jackson, Young-Kwon Hong, and Michael Detmar,
Am. J. Pathol. 2005 Mar;166(3):913-21.
[PDPN]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204930 | PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 2 |
CNY 2400.00 |
|
| RC204930L3 | Lenti ORF clone of Human podoplanin (PDPN), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204930L4 | Lenti ORF clone of Human podoplanin (PDPN), transcript variant 2, mGFP tagged |
CNY 4800.00 |
|
| RG204930 | PDPN (tGFP-tagged) - Human podoplanin (PDPN), transcript variant 2 |
CNY 4000.00 |
