XPA (NM_000380) Human Untagged Clone
CAT#: SC319524
XPA (untagged)-Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1
CNY 2400.00
CNY 2950.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | XP1; XPAC |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_000380.2
GGCTCGCCTCGGCGTGCAGTGCGCGTGCGTGGAGCTGGGAGCTAGGTCCTCGGAGTGGGC
CGGAGATGGCGGCGGCCGACGGGGCTTTGCCGGAGGCGGCGGCTTTAGAGCAACCCGCGG AGCTGCCTGCCTCGGTGCGGGCGAGTATCGAGCGGAAGCGGCAGCGGGCACTGATGCTGC GCCAGGCCCGGCTGGCTGCCCGGCCCTACTCGGCGACGGCGGCTGCGGCTACTGGAGGCA TGGCTAATGTAAAAGCAGCCCCAAAGATAATTGACACAGGAGGAGGCTTCATTTTAGAAG AGGAAGAAGAAGAAGAACAGAAAATTGGAAAAGTTGTTCATCAACCAGGACCTGTTATGG AATTTGATTATGTAATATGCGAAGAATGTGGGAAAGAATTTATGGATTCTTATCTTATGA ACCACTTTGATTTGCCAACTTGTGATAACTGCAGAGATGCTGATGATAAACACAAGCTTA TAACCAAAACAGAGGCAAAACAAGAATATCTTCTGAAAGACTGTGATTTAGAAAAAAGAG AGCCACCTCTTAAATTTATTGTGAAGAAGAATCCACATCATTCACAATGGGGTGATATGA AACTCTACTTAAAGTTACAGATTGTGAAGAGGTCTCTTGAAGTTTGGGGTAGTCAAGAAG CATTAGAAGAAGCAAAGGAAGTCCGACAGGAAAACCGAGAAAAAATGAAACAGAAGAAAT TTGATAAAAAAGTAAAAGAATTGCGGCGAGCAGTAAGAAGCAGCGTGTGGAAAAGGGAGA CGATTGTTCATCAACATGAGTATGGACCAGAAGAAAACCTAGAAGATGACATGTACCGTA AGACTTGTACTATGTGTGGCCATGAACTGACATATGAAAAAATGTGATTTTTTAGTTCAG TGACCTGTTTTATAGAATTTTATATTTAAATAAAGGAAATTTAGATTGGTCCTTTTCAAA ATTCAAAAAAAAAAGCAACATCTTCATAGATGAATGAAACCCTTGTATAAGTAATACTTC AGTAATAATTATGTATGTTATGGCTTAAAAGCAAGTTTCAGTGAAGGTCACCTGGCCTGG TTGTGTGCACAATGTCATGTCTGTGATTGCCTTCTTACAACAGAGATGGGAGCTGAGTGC TAGAGTAGGTGCAGAAGTGGTAGGTCAGCTACAAATTTGAGGACAAGATACCAAGGCAAA CCCTAGATTGGGGTAGAGGGAAAAGGGTTCAACAAAGGCTGAACTGGATTCTTAACCAAG AAACAAATAATAGCAATGGTGGTGCACCACTGTACCCCAGGTTCTAGTCATGTGTTTTTT AGGACGATTTCTGTCTCCACGATGGTGGAAACAGTGGGGAACTACTGCTGGAAAAAGCCC TAATAGCAGAAATAAACATTGAGTTGTACGAGTCTGAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000380 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000380.2, NP_000371.1 |
RefSeq Size | 1439 bp |
RefSeq ORF | 822 bp |
Locus ID | 7507 |
UniProt ID | P23025 |
Domains | XPA_C |
Protein Families | Druggable Genome |
Protein Pathways | Nucleotide excision repair |
Gene Summary | This gene encodes a zinc finger protein plays a central role in nucleotide excision repair (NER), a specialized type of DNA repair. NER is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens and chemotherapeutic drugs. The encoded protein interacts with DNA and several NER proteins, acting as a scaffold to assemble the NER incision complex at sites of DNA damage. Mutations in this gene cause Xeroderma pigmentosum complementation group A (XP-A), an autosomal recessive skin disorder featuring hypersensitivity to sunlight and increased risk for skin cancer. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Evaluation and modulation of DNA lesion bypass in an SV40 large T antigen‐based in vitro replication system
,null,
FEBS Open Bio
,PubMed ID 33512058
[XPA]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204872 | XPA (Myc-DDK-tagged)-Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1 |
CNY 2400.00 |
|
RC204872L1 | Lenti ORF clone of Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC204872L2 | Lenti ORF clone of Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC204872L3 | Lenti ORF clone of Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC204872L4 | Lenti ORF clone of Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
RG204872 | XPA (tGFP-tagged) - Human xeroderma pigmentosum, complementation group A (XPA), transcript variant 1 |
CNY 4000.00 |