PPP1R14A (NM_033256) Human Untagged Clone

CAT#: SC319588

PPP1R14A (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A)



  "NM_033256" in other vectors (6)

CNY 1200.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal CPI17alpha Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPI-17; CPI17; PPP1INL
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_033256.1 CTGGGTCCAGCAGCGCGATGGCAGCTCAGCGGCTGGGCAAGCGCGTGCTGAGCAAGCTGC
AGTCTCCATCGCGGGCCCGCGGGCCAGGGGGCAGTCCCGGGGGGCTGCAGAAGCGGCACG
CGCGCGTCACCGTCAAGTATGACCGGCGGGAGCTGCAGCGGCGGCTGGACGTGGAGAAGT
GGATCGACGGGCGCCTGGAGGAGCTGTACCGCGGCATGGAGGCAGACATGCCCGATGAGA
TCAACATTGATGAATTGTTGGAGTTAGAGAGTGAAGAGGAGAGAAGCCGGAAAATCCAGG
GACTCCTGAAGTCATGTGGGAAACCTGTCGAGGACTTCATCCAGGAGCTGCTGGCAAAGC
TTCAAGGCCTCCACAGGCAGCCCGGCCTCCGCCAGCCAAGCCCCTCCCACGACGGCAGCC
TCAGCCCCCTCCAGGACCGGGCCCGGACTGCTCACCCCTGACCCTCTTGCACTCTCCCTG
CCCCCCGGACGCCGCCCAGCTTGCTTGTGTATAAGTTGTATTTAATGGTTCTGTAACAAT
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_033256
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033256.1, NP_150281.1
RefSeq Size 723 bp
RefSeq ORF 444 bp
Locus ID 94274
UniProt ID Q96A00
Domains PP1_inhibitor
Protein Families Druggable Genome
Protein Pathways Vascular smooth muscle contraction
Gene Summary The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1, also known as CPI-17alpha).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...