Tbp7 (PSMC4) (NM_006503) Human Untagged Clone
CAT#: SC319607
PSMC4 (untagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1
CNY 3656.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MIP224; RPT3; S6; TBP-7; TBP7 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_006503.2
CAGAGGCCGGCTTGGTCACTATGGAGGAGATAGGCATCTTGGTGGAGAAGGCTCAGGATG
AGATCCCAGCACTGTCCGTGTCCCGGCCCCAGACCGGCCTGTCCTTCCTGGGCCCTGAGC CTGAGGACCTGGAGGACCTGTACAGCCGCTACAAGAAGCTGCAGCAAGAGCTGGAGTTCC TGGAGGTGCAGGAGGAATACATCAAAGATGAGCAAAAGAACCTGAAAAAGGAATTTCTCC ATGCCCAGGAGGAGGTGAAGCGAATCCAAAGCATCCCGCTGGTCATCGGACAATTTCTGG AGGCTGTGGATCAGAATACAGCCATCGTGGGCTCTACCACAGGCTCCAACTATTATGTGC GCATCCTGAGCACCATCGATCGGGAGCTGCTCAAGCCCAACGCCTCAGTGGCCCTCCACA AGCACAGCAATGCACTGGTGGACGTGCTGCCCCCCGAAGCCGACAGCAGCATCATGATGC TCACCTCAGACCAGAAGCCAGATGTGATGTACGCGGACATCGGAGGCATGGACATCCAGA AGCAGGAGGTGCGGGAGGCCGTGGAGCTCCCGCTCACGCATTTCGAGCTCTACAAGCAGA TCGGCATCGATCCCCCCCGAGGCGTCCTCATGTATGGCCCACCTGGCTGTGGGAAGACCA TGTTGGCAAAGGCGGTGGCACATCACACAACAGCTGCATTCATCCGGGTCGTGGGCTCGG AGTTTGTACAGAAGTATCTGGGTGAGGGCCCCCGCATGGTCCGGGATGTGTTCCGCCTGG CCAAGGAGAATGCACCTGCCATCATCTTCATAGACGAGATTGATGCCATCGCCACCAAGA GATTCGATGCTCAGACAGGGGCCGACAGGGAGGTTCAGAGGATCCTGCTGGAGCTGCTGA ATCAGATGGATGGATTTGATCAGAATGTCAATGTCAAGGTAATCATGGCCACAAACAGAG CAGACACCCTGGATCCGGCCCTGCTACGGCCAGGACGGCTGGACCGTAAAATTGAATTTC CACTTCCTGACCGCCGCCAGAAGAGATTGATTTTCTCCACTATCACTAGCAAGATGAACC TCTCTGAGGAGGTTGACTTGGAAGACTATGTGGCCCGGCCAGATAAGATTTCAGGAGCTG ATATTAACTCCATCTGTCAGGAGAGTGGAATGTTGGCTGTCCGTGAAAACCGCTACATTG TCCTGGCCAAGGACTTCGAGAAAGCATACAAGACTGTCATCAAGAAGGACGAGCAGGAGC ATGAGTTTTACAAGTGACCCTTCCCTTCCCTCCACCACACCACTCAGGGGCTGGGGCTTC TCTCGCACCCCCAGCACCTCTGTCCCAAAACCTCATTCCCTTTTTTCTTTACCCAGGATT GGTTTCTTCAATAAATAGATAAGATCGAATCCAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006503 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006503.2, NP_006494.1 |
| RefSeq Size | 1450 bp |
| RefSeq ORF | 1257 bp |
| Locus ID | 5704 |
| UniProt ID | P43686 |
| Domains | AAA, AAA |
| Protein Families | Druggable Genome |
| Protein Pathways | Proteasome |
| Gene Summary | The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the triple-A family of ATPases that is a component of the 19S regulatory subunit and plays a role in 26S proteasome assembly. The encoded protein interacts with gankyrin, a liver oncoprotein, and may also play a role in Parkinson's disease through interactions with synphilin-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204932 | PSMC4 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1 |
CNY 3656.00 |
|
| RC204932L1 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, Myc-DDK-tagged |
CNY 6056.00 |
|
| RC204932L2 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC204932L3 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204932L4 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG204932 | PSMC4 (tGFP-tagged) - Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1 |
CNY 5256.00 |
