Solute carrier family 22 member 18 (SLC22A18) (NM_183233) Human Untagged Clone
CAT#: SC319659
SLC22A18 (untagged)-Human solute carrier family 22, member 18 (SLC22A18), transcript variant 2
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BWR1A; BWSCR1A; HET; IMPT1; ITM; ORCTL2; p45-BWR1A; SLC22A1L; TSSC5 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_183233.1
GACAAAAAAAAAGGTCTCTCCGATTTCCTCTGCTCAACCAGTTCCCTGGCTACCTGAGGC
CCTGCTTCACCTGGAGGAAGACAGTGGCAAGGCCAGGCGGGTGCTGCCTGGGACCCAGTG ACTCAGCACCCCTGCCCGGATCAACTGGACTTTTGCCCCCTGCTCCGCCAGCCTCCTGCT TGGATCTCTCCTGGGTCTCCCTGCTGCGCCTGTCCAGGATGCAGGGAGCTCGGGCTCCCA GGGACCAGGGCCAGTCCCCCGGCAGGATGAGCGCTCTAGGCCGGTCCTCGGTCATCTTGC TTACCTACGTGCTGGCCGCCACAGAACTTACCTGCCTCTTCATGCAGTTCTCCATCGTGC CATACCTGTCTCGGAAACTGGGCCTGGATTCCATTGCCTTCGGCTACCTGCAAACCACCT TCGGGGTGCTGCAGCTGCTGGGCGGGCCGGTGTTTGGCAGGTTCGCAGACCAGCGCGGGG CGCGGGCGGCGCTCACGCTCTCCTTCCTGGCTGCCTTGGCGCTCTACCTGCTCCTGGCGG CCGCCTCCAGCCCGGCCCTGCCCGGGGTCTACCTGCTCTTCGCCTCGCGCCTGCCCGGAG CGCTCATGCACACGCTGCCAGCCGCCCAGATGGTCATCACGGACCTGTCGGCACCCGAGG AGCGGCCCGCGGCCCTGGGCCGGCTGGGCCTCTGCTTCGGCGTCGGAGTCATCCTCGGCT CCCTGCTGGGCGGGACCCTGGTCTCCGCGTACGGGATTCAGTGCCCGGCCATCCTGGCTG CCCTGGCCACCCTCCTGGGAGCTGTCCTCAGCTTCACCTGCATCCCCGCCAGCACCAAAG GGGCCAAAACTGACGCCCAGGCTCCACTGCCAGGCGGCCCCCGGGCCAGTGTGTTCGACC TGAAGGCCATCGCCTCCCTGCTGCGGCTGCCAGACGTCCCGAGGATCTTCCTGGTGAAGG TGGCCTCCAACTGCCCCACAGGGCTCTTCATGGTCATGTTCTCCATCATCTCCATGGACT TCTTCCAGCTGGAGGCCGCCCAAGCTGGCTACCTCATGTCCTTCTTCGGGCTCCTCCAGA TGGTGACCCAGGGCCTGGTCATCGGGCAGCTGAGCAGCCACTTCTCGGAGGAGGTGCTGC TCCGGGCCAGCGTGCTGGTCTTCATCGTGGTGGGCCTGGCCATGGCCTGGATGTCCAGCG TCTTCCACTTCTGCCTCCTGGTGCCCGGCCTGGTGTTCAGCCTCTGCACCCTCAACGTGG TCACCGACAGCATGCTGATCAAGGCTGTCTCCACCTCGGACACAGGGACCATGCTGGGCC TCTGCGCCTCTGTACAACCACTGCTCCGAACTCTGGGACCCACGGTCGGCGGCCTCCTGT ACCGCAGCTTTGGCGTCCCCGTCTTCGGCCACGTGCAGGTTGCTATCAATACCCTTGTCC TCCTGGTCCTCTGGAGGAAACCTATGCCCCAGAGGAAGGACAAAGTCCGGTGACCGCTGC CCAGACACAGACTGGCAATAAACTCCTACTAAATCCCTCCGAAAAAAAAAAAAAAAAAAA AAA |
Restriction Sites | Please inquire |
ACCN | NM_183233 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_183233.1, NP_899056.1 |
RefSeq Size | 1563 bp |
RefSeq ORF | 1275 bp |
Locus ID | 5002 |
UniProt ID | Q96BI1 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 3. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 1 and 2 both encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204889 | SLC22A18 (Myc-DDK-tagged)-Human solute carrier family 22, member 18 (SLC22A18), transcript variant 2 |
CNY 5488.00 |
|
RC204889L3 | Lenti ORF clone of Human solute carrier family 22, member 18 (SLC22A18), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC204889L4 | Lenti ORF clone of Human solute carrier family 22, member 18 (SLC22A18), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG204889 | SLC22A18 (tGFP-tagged) - Human solute carrier family 22, member 18 (SLC22A18), transcript variant 2 |
CNY 7088.00 |
其它Solute carrier family 22 member 18产品