HUS1 (NM_004507) Human Untagged Clone

CAT#: SC319724

HUS1 (untagged)-Human HUS1 checkpoint homolog (S. pombe) (HUS1), transcript variant 1



  "NM_004507" in other vectors (6)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal antibody to HUS1 (HUS1 checkpoint homolog (S. pombe))
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hHUS1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004507.2 GCCGCGGCTGCGCCATCCGCGGCCATGAAGTTTCGGGCCAAGATCGTGGACGGGGCCTGT
CTGAACCACTTCACACGAATCAGTAACATGATAGCCAAGCTTGCCAAAACCTGCACCCTC
CGCATCAGCCCTGATAAGCTTAACTTCATCCTTTGTGACAAGCTGGCTAATGGAGGAGTG
AGCATGTGGTGTGAGCTGGAACAGGAGAACTTCTTCAACGAATTTCAAATGGAGGGTGTC
TCTGCAGAAAACAATGAGATTTATTTAGAGCTAACATCGGAAAACTTATCTCGAGCCTTG
AAGACTGCCCAGAATGCCAGGGCTTTGAAAATCAAACTGACTAATAAACACTTTCCCTGC
CTCACGGTCTCCGTGGAGCTGTTATCTATGTCAAGCAGTAGCCGCATTGTGACCCATGAC
ATCCCCATAAAGGTGATTCCTAGGAAATTGTGGAAGGACTTACAAGAACCGGTGGTCCCA
GATCCTGATGTTAGTATTTATTTACCAGTCTTGAAGACTATGAAGAGTGTTGTGGAAAAA
ATGAAAAACATCAGCAATCACCTTGTTATTGAAGCAAACCTAGATGGAGAATTGAATTTG
AAAATAGAAACTGAATTAGTATGTGTTACAACTCATTTTAAAGATCTTGGAAATCCTCCA
TTAGCCTCTGAAAGCACCCATGAGGACAGAAACGTGGAACACATGGCTGAAGTGCACATA
GATATTAGGAAGCTCCTACAGTTTCTTGCTGGACAACAAGTAAATCCCACAAAGGCCTTA
TGCAATATTGTGAATAACAAGATGGTGCATTTTGATCTGCTTCATGAAGACGTGTCCCTT
CAGTATTTCATCCCTGCGCTGTCCTAGCACCCTGTCGCTGGAGTTGGCATGCAGAGACTT
TGTCAGGATGGGAGAGGCCGCAGGTGTTGTGTTCTGATCACTGGTCTGTGCCCTCACAGC
ACCGCACATCGACACACTGTACTTATTTGTCCCTCTCTAACATTTTAACTAAAAGTTGAT
TCAACAACACACAGTTGGATAAACATATCACTTCATGTTAAAAAAAAAAAATAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004507
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004507.2, NP_004498.1
RefSeq Size 2143 bp
RefSeq ORF 843 bp
Locus ID 3364
UniProt ID O60921
Domains Hus1
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a component of an evolutionarily conserved, genotoxin-activated checkpoint complex that is involved in the cell cycle arrest in response to DNA damage. This protein forms a heterotrimeric complex with checkpoint proteins RAD9 and RAD1. In response to DNA damage, the trimeric complex interacts with another protein complex consisting of checkpoint protein RAD17 and four small subunits of the replication factor C (RFC), which loads the combined complex onto the chromatin. The DNA damage induced chromatin binding has been shown to depend on the activation of the checkpoint kinase ATM, and is thought to be an early checkpoint signaling event. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes a protein of 280 aa.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...