hCG beta (CGB7) (NM_033142) Human Untagged Clone
CAT#: SC319883
CGB7 (untagged)-Human chorionic gonadotropin, beta polypeptide 7 (CGB7)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CG-beta-a; CGB6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_033142.1
GAATGGCTCAAGTAGAGGAGAGTTGAGGCTTCAGTCCAGCACTTTTCTCGGGTCACGGCC
TCCTCCTGGTTCCCAAGACCCCACCATAGGCAGAGGCAGGCCTTCCTACACCCTACTCTC TGTGCCTCCAGCCTCGACTAGTCCCTAACACTCGACGACTGAGTCTCAGAGGTCACTTCA CCGTGGTCTCCGCCTCATCCTTGGCGCTAGACCACTGAGGGGAGAGGACTGGGGTGCTCC GCTGAGCCACTCCTGTGCCTCCCTGGCCTTGTCTACTTCTCGCCCCCCGAAGGGTTAGTG TCGAGCTCACTCCAGCATCCTACAACCTCCTGGTGGCCTTGCCGCCCCCACAACCCCGAG GTATAAAGCCAGGTACACCAGGCAGGGGACGCACCAAGGATGGAGATGTTCCAGGGGCTG CTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAGGAGCCGCTTCGGCCA CGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGCTGCCCCGTGTGCATC ACCGTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACCCGCGTGCTGCAGGGG GTCCTGCCGGCCCTGCCTCAGGTGGTGTGCAACTACCGCGATGTGCGCTTCGAGTCCATC CGGCTCCCTGGCTGCCCGCGCGGCGTGAACCCCGTGGTCTCCTACGCCGTGGCTCTCAGC TGTCAATGTGCACTCTGCCGCCGCAGCACCACTGACTGCGGGGGTCCCAAGGACCACCCC TTGACCTGTGATGACCCCCGCTTCCAGGCCTCCTCTTCCTCAAAGGCCCCTCCCCCCAGC CTTCCAAGTCCATCCCGACTCCCGGGGCCCTCGGACACCCCGATCCTCCCACAATAAAGG CTTCTCAATCCGCAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_033142 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033142.1, NP_149133.1 |
RefSeq Size | 880 bp |
RefSeq ORF | 498 bp |
Locus ID | 94027 |
UniProt ID | P01233 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 7 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208311 | CGB7 (Myc-DDK-tagged)-Human chorionic gonadotropin, beta polypeptide 7 (CGB7) |
CNY 1200.00 |
|
RC208311L1 | Lenti ORF clone of Human chorionic gonadotropin, beta polypeptide 7 (CGB7), Myc-DDK-tagged |
CNY 3600.00 |
|
RC208311L2 | Lenti ORF clone of Human chorionic gonadotropin, beta polypeptide 7 (CGB7), mGFP tagged |
CNY 5890.00 |
|
RC208311L3 | Lenti ORF clone of Human chorionic gonadotropin, beta polypeptide 7 (CGB7), Myc-DDK-tagged |
CNY 5890.00 |
|
RC208311L4 | Lenti ORF clone of Human chorionic gonadotropin, beta polypeptide 7 (CGB7), mGFP tagged |
CNY 5890.00 |
|
RG208311 | CGB7 (tGFP-tagged) - Human chorionic gonadotropin, beta polypeptide 7 (CGB7) |
CNY 2800.00 |
其它hCG beta产品