Tropomyosin 2 (TPM2) (NM_213674) Human Untagged Clone
CAT#: SC319910
TPM2 (untagged)-Human tropomyosin 2 (beta) (TPM2), transcript variant 2
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AMCD1; DA1; DA2B; DA2B4; HEL-S-273; NEM4; TMSB |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_213674.1
CCCAGCCCAGTCCGTCCGGTCCTCACCGCCTGCCGGCCGGCCCACCCCCCACCGCAGCCA
TGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAACGCCATCGACC GCGCCGAGCAGGCCGAAGCCGACAAGAAGCAAGCTGAGGACCGCTGCAAGCAGCTGGAGG AGGAGCAGCAGGCCCTCCAGAAGAAGCTGAAGGGGACAGAGGATGAGGTGGAAAAGTATT CTGAATCCGTGAAGGAGGCCCAGGAGAAACTGGAGCAGGCCGAGAAGAAGGCCACTGATG CTGAGGCAGATGTGGCCTCCCTGAACCGCCGCATTCAGCTGGTTGAGGAGGAGCTGGACC GGGCCCAGGAGCGCCTGGCTACAGCCCTGCAGAAGCTGGAGGAGGCCGAGAAGGCGGCTG ATGAGAGCGAGAGAGGAATGAAGGTCATCGAAAACCGGGCCATGAAGGATGAGGAGAAGA TGGAACTGCAGGAGATGCAGCTGAAGGAGGCCAAGCACATCGCTGAGGATTCAGACCGCA AATATGAAGAGGTGGCCAGGAAGCTGGTGATCCTGGAAGGAGAGCTGGAGCGCTCGGAGG AGAGGGCTGAGGTGGCCGAGAGCCGAGCCAGACAGCTGGAGGAGGAACTTCGAACCATGG ACCAGGCCCTCAAGTCCCTGATGGCCTCAGAGGAGGAGTATTCCACCAAAGAAGATAAAT ATGAAGAGGAGATCAAACTGTTGGAGGAGAAGCTGAAGGAGGCTGAGACCCGAGCAGAGT TTGCCGAGAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTAGAAGAGACCTTGG CCAGTGCCAAGGAGGAGAACGTCGAGATTCACCAGACCTTGGACCAGACCCTGCTGGAAC TCAACAACCTGTGAGGGCCAGCCCCACCCCCAGCCAGGCTATGGTTGCCACCCCAACCCA ATAAAACTGATGTTACTAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_213674 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_213674.1, NP_998839.1 |
RefSeq Size | 1182 bp |
RefSeq ORF | 855 bp |
Locus ID | 7169 |
UniProt ID | P07951 |
Protein Pathways | Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM) |
Gene Summary | This gene encodes beta-tropomyosin, a member of the actin filament binding protein family, and mainly expressed in slow, type 1 muscle fibers. Mutations in this gene can alter the expression of other sarcomeric tropomyosin proteins, and cause cap disease, nemaline myopathy and distal arthrogryposis syndromes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009] Transcript Variant: This variant (Tpm2.1, also known as variant 2) has an alternate internal exon and an alternate 3' exon, as compared to variant Tpm2.2. The resulting isoform (Tpm2.1sm/cy, also known as isoform 2) has a different internal segment and a different C-terminus, but has the same protein size, as compared to isoform Tpm2.2st. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204007 | TPM2 (Myc-DDK-tagged)-Human tropomyosin 2 (beta) (TPM2), transcript variant 2 |
CNY 3990.00 |
|
RC204007L3 | Lenti ORF clone of Human tropomyosin 2 (beta) (TPM2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC204007L4 | Lenti ORF clone of Human tropomyosin 2 (beta) (TPM2), transcript variant 2, mGFP tagged |
CNY 5040.00 |
|
RG204007 | TPM2 (tGFP-tagged) - Human tropomyosin 2 (beta) (TPM2), transcript variant 2 |
CNY 4370.00 |
其它Tropomyosin 2产品