Nucleophosmin (NPM1) (NM_001037738) Human Untagged Clone
CAT#: SC319950
NPM1 (untagged)-Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3
CNY 2400.00
CNY 3990.00
Product images
 
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | B23; NPM | 
| Vector | pCMV6-AC | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | >OriGene sequence for NM_001037738.1
GGGGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT CCGTCCGCCTTCTCTCCTACCTAAGTGCGTGCCGCCACCCGATGGAAGATTCGATGGACA TGGACATGAGCCCCCTGAGGCCCCAGAACTATCTTTTCGGTTGTGAACTAAAGGCCGACA AAGATTATCACTTTAAGGTGGATAATGATGAAAATGAGCACCAGTTATCTTTAAGAACGG TCAGTTTAGGGGCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATT ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG TTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAG GGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAG ATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAG GTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATG ATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTG AAGAAAAAGCGCCAGTGAAGAAATCTATACGAGATACTCCAGCCAAAAATGCACAAAAGT CAAATCAGAATGGAAAAGACTCAAAACCATCATCAACACCAAGATCAAAAGGACAAGAAT CCTTCAAGAAACAGGAAAAAACTCCTAAAACACCAAAAGGACCTAGTTCTGTAGAAGACA TTAAAGCAAAAATGCAAGCAAGTATAGAAAAAGCGCATTGAACAGTCCTGGGCACTACAT GTAAATTAAGCCCAAAGATGGGGAGAAAGGAAAAGGAGAGACAAATATAGTCCATACTGA GTGTCATCAACAATCCAGACTGAAGTCTTCTATTTTAATCTCAATCCCCTTTTCTGATTT GCCACCCATGCCTCTTCAGGCTGGAAACAATCTCTTGGTTCCCTAAAGCACTTTCTTCTG ACTGCTGTGATTCAGTGAACCTTGCCCTTTGCTTTCTATTACTTGTGCATTTGCCTCACC TGACAATGTTTTAAATCGCCTTTGTATCTCCTTAGCTGCTCAATAAATATTTGAATGCAT CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA | 
| Restriction Sites | Please inquire | 
| ACCN | NM_001037738 | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. | 
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_001037738.1, NP_001032827.1 | 
| RefSeq Size | 1274 bp | 
| RefSeq ORF | 780 bp | 
| Locus ID | 4869 | 
| UniProt ID | P06748 | 
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors | 
| Gene Summary | The protein encoded by this gene is involved in several cellular processes, including centrosome duplication, protein chaperoning, and cell proliferation. The encoded phosphoprotein shuttles between the nucleolus, nucleus, and cytoplasm, chaperoning ribosomal proteins and core histones from the nucleus to the cytoplasm. This protein is also known to sequester the tumor suppressor ARF in the nucleolus, protecting it from degradation until it is needed. Mutations in this gene are associated with acute myeloid leukemia. Dozens of pseudogenes of this gene have been identified. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (3) utilizes an alternate 3'-terminal exon, compared to variant 1, resulting in a shorter protein (isoform 3) with a distinct C-terminus. | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC210458 | NPM1 (Myc-DDK-tagged)-Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3 | 
                                                        
                                                        
                                                        
                                                            CNY 2400.00 | |
| RC210458L1 | Lenti ORF clone of Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3, Myc-DDK-tagged | 
                                                        
                                                        
                                                        
                                                            CNY 4800.00 | |
| RC210458L2 | Lenti ORF clone of Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3, mGFP tagged | CNY 5890.00 | |
| RC210458L3 | Lenti ORF clone of Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3, Myc-DDK-tagged | CNY 5890.00 | |
| RC210458L4 | Lenti ORF clone of Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3, mGFP tagged | CNY 5890.00 | |
| RG210458 | NPM1 (tGFP-tagged) - Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 3 | 
                                                        
                                                        
                                                        
                                                            CNY 4000.00 | 
其它Nucleophosmin产品


 
        