FGF18 (NM_003862) Human Untagged Clone
CAT#: SC320149
FGF18 (untagged)-Human fibroblast growth factor 18 (FGF18)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FGF-18; ZFGF5 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003862.1
GGCACGAGGGTCTGCAGCAGCAGCAGCCGGCGAGGAGGGAGCAGCAGCAGCGGCGGCGGC
GGCGGCGGCGGCGGCGGAGGCGCCCGGTCCCGGCCGCGCGGAGCGGACATGTGCAGGCTG GGCTAGGAGCCGCCGCCTCCCTCCCGCCCAGCGATGTATTCAGCGCCCTCCGCCTGCACT TGCCTGTGTTTACACTTCCTGCTGCTGTGCTTCCAGGTACAGGTGCTGGTTGCCGAGGAG AACGTGGACTTCCGCATCCACGTGGAGAACCAGACGCGGGCTCGGGACGATGTGAGCCGT AAGCAGCTGCGGCTGTACCAGCTCTACAGCCGGACCAGTGGGAAACACATCCAGGTCCTG GGCCGCAGGATCAGTGCCCGCGGCGAGGATGGGGACAAGTATGCCCAGCTCCTAGTGGAG ACAGACACCTTCGGTAGTCAAGTCCGGATCAAGGGCAAGGAGACGGAATTCTACCTGTGC ATGAACCGCAAAGGCAAGCTCGTGGGGAAGCCCGATGGCACCAGCAAGGAGTGTGTGTTC ATCGAGAAGGTTCTGGAGAACAACTACACGGCCCTGATGTCGGCTAAGTACTCCGGCTGG TACGTGGGCTTCACCAAGAAGGGGCGGCCGCGGAAGGGCCCCAAGACCCGGGAGAACCAG CAGGACGTGCATTTCATGAAGCGCTACCCCAAGGGGCAGCCGGAGCTTCAGAAGCCCTTC AAGTACACGACGGTGACCAAGAGGTCCCGTCGGATCCGGCCCACACACCCTGCCTAGGCC ACCCCGCCGCGGCCCCTCAGGTCGCCCTGGCCACACTCACACTCCCAGAAAACTGCATCA GAGGAATATTTTTACATGAAAAATAAGGAAGAAGCTCTATTTTTGTACATTGTGTTTAAA AGAAGACAAAAACTGAACCAAAACTCTTGGGGGGAGGGGTGATAAGGATTTTATTGTTGA CTTGAAACCCCCGATGACAAAAGACTCACGCAAAGGGACTGTAGTCAACCCACAGGTGCT TGTCTCTCTCTAGGAACAGACAACTTTAAACTCGTCCCCAGAGGAGGACTTGAATGAGGA AACCAACACTTTGAGAAACCAAAGTCCTTTTTCCCAAAGGTTTTGAAAGGAAAAAAAAAA AAAACAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003862 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003862.1, NP_003853.1 |
| RefSeq Size | 1546 bp |
| RefSeq ORF | 624 bp |
| Locus ID | 8817 |
| UniProt ID | O76093 |
| Protein Families | ES Cell Differentiation/IPS, Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) contains a 3' UTR region absent in variant 2. Variants 1 and 2 encode the identical protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202482 | FGF18 (Myc-DDK-tagged)-Human fibroblast growth factor 18 (FGF18) |
CNY 2400.00 |
|
| RC202482L1 | Lenti ORF clone of Human fibroblast growth factor 18 (FGF18), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC202482L2 | Lenti ORF clone of Human fibroblast growth factor 18 (FGF18), mGFP tagged |
CNY 4800.00 |
|
| RC202482L3 | Lenti ORF clone of Human fibroblast growth factor 18 (FGF18), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC202482L4 | Lenti ORF clone of Human fibroblast growth factor 18 (FGF18), mGFP tagged |
CNY 4800.00 |
|
| RG202482 | FGF18 (tGFP-tagged) - Human fibroblast growth factor 18 (FGF18) |
CNY 4000.00 |
