ARD1A (NAA10) (NM_003491) Human Untagged Clone

CAT#: SC320239

NAA10 (untagged)-Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10)



  "NM_003491" in other vectors (6)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
NAA10 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003491.2 AGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGGAGCGCGGCGGC
AGCTGACTGCGCCTTCACGATCCGCTGGGACCCGCGAGCCCCGCCGCCGTTATGAACATC
CGCAATGCGAGGCCAGAGGACCTAATGAACATGCAGCACTGCAACCTCCTCTGCCTGCCC
GAGAACTACCAGATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTAC
ATTGCTGAGGACGAGAATGGGAAGATTGTGGGGTATGTCCTGGCCAAAATGGAAGAGGAC
CCAGATGATGTGCCCCATGGACATATCACCTCATTGGCTGTGAAGCGTTCCCACCGGCGC
CTCGGTCTGGCTCAGAAACTGATGGACCAGGCCTCTCGAGCCATGATAGAGAACTTCAAT
GCCAAATATGTCTCCCTGCATGTCAGGAAGAGTAACCGGGCCGCCCTGCACCTCTATTCC
AACACCCTCAACTTTCAGATCAGTGAAGTGGAGCCCAAATACTATGCAGATGGGGAGGAC
GCCTATGCCATGAAGCGGGACCTCACTCAGATGGCCGACGAGCTGAGGCGGCACCTGGAG
CTGAAAGAGAAGGGCAGGCACGTGGTGCTGGGTGCCATCGAGAACAAGGTGGAGAGCAAA
GGCAATTCACCTCCGAGCTCAGGAGAGGCCTGTCGCGAGGAGAAGGGCCTGGCTGCCGAG
GATAGTGGTGGGGACAGCAAGGACCTCAGCGAGGTCAGCGAGACCACAGAGAGCACAGAT
GTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAGAGCCTGCCCCATCCCCTCCTC
ACCCCACGAGCTTTCACAATAAATTTGCTCCGTGGCACTGGGAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_003491
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003491.2, NP_003482.1
RefSeq Size 916 bp
RefSeq ORF 708 bp
Locus ID 8260
UniProt ID P41227
Domains Acetyltransf
Protein Families Druggable Genome
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...