TFIIS (TCEA2) (NM_198723) Human Untagged Clone
CAT#: SC320353
TCEA2 (untagged)-Human transcription elongation factor A (SII), 2 (TCEA2), transcript variant 2
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TFIIS |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_198723.1
GTCGGCTGCGGCGGGTGTGGGAGGTGGCGACGGCCGGGGCCGGGGTCCTGCCCGGCTGCG
GAGGCGGGCGCGACGGGCGCGGGGGTCGCTGCTCCTGAGGCGATGATGGGCAAGGAAGAG GAGATTGCGCGGATCGCCCGGAGGCTGGACAAGATGGTGACCAAGAAGAGCGCGGAGGGA GCCATGGATTTGCTGCGGGAGCTGAAGGCCATGCCTATCACGCTGCACCTGCTCCAGTCC ACCCGAGTCGGGATGTCTGTCAACGCCCTTCGGAAGCAGAGCTCGGATGAGGAGGTCATT GCACTGGCCAAGTCTCTCATCAAGTCCTGGAAGAAGCTCCTGGATGCTTCCGATGCCAAA GCCAGGGAGCGGGGGAGGGGCATGCCTCTGCCCACGTCCTCGAGGGATGCCTCAGAGGCC CCGGATCCCAGCCGCAAGAGGCCGGAGCTGCCCAGGGCACCGTCGACTCCGAGGATCACC ACATTTCCTCCGGTGCCTGTCACCTGTGATGCCGTGCGCAACAAGTGCCGCGAGATGCTG ACCGCTGCCCTGCAGACGGACCATGACCACGTGGCCATCGGTGCGGACTGCGAGCGCCTG TCGGCTCAGATCGAGGAATGCATCTTCCGGGACGTTGGAAACACAGACATGAAGTATAAG AACCGTGTACGGAGTCGTATCTCCAACCTGAAGGATGCCAAGAACCCTGACCTGCGGCGG AATGTGCTGTGTGGGGCCATAACACCCCAGCAGATCGCTGTGATGACCTCAGAGGAGATG GCCAGTGATGAGCTGAAGGAGATCCGTAAGGCCATGACCAAGGAGGCCATCCGAGAGCAC CAGATGGCCCGCACTGGCGGCACGCAGACAGACCTGTTCACCTGCGGCAAGTGCAGGAAA AAGAACTGCACCTACACACAGGTGCAGACCCGCAGCTCTGATGAGCCCATGACCACCTTT GTTGTCTGCAACGAGTGTGGAAACCGCTGGAAGTTCTGCTGACCCCTCGTGTAGATGTGC TGCAGCCTTGGGCCCTCCCCGGCCCACGTCCTCCGTTGACACAGCTTCTCTGGAGACCCT AGAAGGCGGCATGTCCTGCCCTCAACCTGCCTGCCTGGATTGCACCTTTCTGCCCTTTCC CCCTCATTATTAAATGTTTCTTTTTGCCAAAAAAAACAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_198723 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198723.1, NP_942016.1 |
RefSeq Size | 1661 bp |
RefSeq ORF | 819 bp |
Locus ID | 6919 |
UniProt ID | Q15560 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202427 | TCEA2 (Myc-DDK-tagged)-Human transcription elongation factor A (SII), 2 (TCEA2), transcript variant 2 |
CNY 2400.00 |
|
RC202427L3 | Lenti ORF clone of Human transcription elongation factor A (SII), 2 (TCEA2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC202427L4 | Lenti ORF clone of Human transcription elongation factor A (SII), 2 (TCEA2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG202427 | TCEA2 (tGFP-tagged) - Human transcription elongation factor A (SII), 2 (TCEA2), transcript variant 2 |
CNY 4370.00 |
|
SC107876 | TCEA2 (untagged)-Human transcription elongation factor A (SII), 2 (TCEA2), transcript variant 2 |
CNY 6270.00 |