IMMP1L (NM_144981) Human Untagged Clone

CAT#: SC320466

IMMP1L (untagged)-Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein



  "NM_144981" in other vectors (5)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IMMP1; IMP1; IMP1-LIKE
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_144981.1 GAGAAAGGCCCACCTGTGTCCTGGTTGAGGGTCTCCAGGGTTCTTTGGGGCCCGAGGCCA
ATGGTGGCAGAGTCTACATAGAACTATGCTTCGTGGTGTTCTGGGGAAAACCTTTCGACT
TGTTGGCTATACTATTCAATATGGCTGTATAGCTCATTGTGCTTTTGAATACGTTGGTGG
TGTTGTCATGTGTTCTGGACCATCAATGGAGCCTACAATTCAAAATTCAGATATTGTCTT
TGCAGAAAATCTTAGTCGACATTTTTATGGTATCCAAAGAGGTGACATTGTGATTGCAAA
AAGCCCAAGTGATCCAAAATCAAATATTTGTAAAAGAGTAATTGGTTTGGAAGGAGACAA
AATCCTCACCACTAGTCCATCAGATTTCTTTAAAAGCCATAGTTATGTGCCAATGGGTCA
TGTTTGGTTAGAAGGTGACAATCTACAGAATTCTACAGATTCCAGGTGCTATGGACCTAT
TCCATATGGACTAATAAGAGGACGAATCTTCTTTAAGATTTGGCCTCTGAGTGATTTTGG
ATTTTTACGTGCCAGCCCTAATGGCCACAGATTTTCTGATGATTAGTAAGCATTTATTCT
TTTGACTTGATTATTGTCTCCTTTTCATGTGAATTTATTACTCCCGTTGAAACCGTGTAC
TTACCAATAAACTATTTGCTATTCAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_144981
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_144981.1, NP_659418.1
RefSeq Size 795 bp
RefSeq ORF 501 bp
Locus ID 196294
UniProt ID Q96LU5
Domains Peptidase_S26
Protein Families Protease
Gene Summary The mitochondrial inner membrane peptidase (IMP) complex generates mature, active proteins in the mitochondrial intermembrane space by proteolytically removing the mitochondrial targeting presequence of nuclear-encoded proteins. IMP1 and IMP2 (IMMP2L; MIM 605977) are the catalytic subunits of the IMP complex (Burri et al., 2005 [PubMed 15814844]).[supplied by OMIM, Sep 2008]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...