PPP4C (NM_002720) Human Untagged Clone
CAT#: SC320616
PPP4C (untagged)-Human protein phosphatase 4, catalytic subunit (PPP4C)
CNY 2400.00
CNY 2950.00
Product images
                    
                
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 2700.00
                                                
                                            
Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | PP-X; PP4; PP4C; PPH3; PPP4; PPX | 
| Vector | pCMV6-AC | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >OriGene sequence for NM_002720.1
CGGTCGAAAGCGGAGTGAAAGAGGGAGGCAGGGAGCCGGAGAGCCGGAACCGGAGTCGCA 
GCGGCGGTAATAGAGACCCCTGTGCGGTGCGGAGGGGGCGGCGGCCCCGACTCTGACCCG CGCCGGGGGTGGGCCATGGCGGAGATCAGCGACCTGGACCGGCAGATCGAGCAGCTGCGT CGCTGCGAGCTCATCAAGGAGAGCGAAGTCAAGGCCCTGTGCGCTAAGGCCAGAGAGATC TTGGTAGAGGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTGTGCGGCGACATC CATGGACAATTCTATGACCTCAAAGAGCTGTTCAGAGTAGGTGGCGACGTCCCTGAGACC AACTACCTCTTCATGGGGGACTTTGTGGACCGTGGCTTCTATAGCGTCGAAACGTTCCTC CTGCTGCTGGCACTTAAGGTTCGCTATCCTGATCGCATCACACTGATCCGGGGCAACCAT GAGAGTCGCCAGATCACGCAGGTCTATGGCTTCTACGATGAGTGCCTGCGCAAGTACGGC TCGGTGACTGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCCATC ATCGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCCTCCATCCAGACCCTGGAT CAGATTCGGACAATCGACCGAAAGCAAGAGGTGCCTCATGATGGGCCCATGTGTGACCTC CTCTGGTCTGACCCAGAAGACACCACAGGCTGGGGCGTGAGCCCCCGAGGAGCCGGCTAC CTATTTGGCAGTGACGTGGTGGCCCAGTTCAACGCAGCCAATGACATTGACATGATCTGC CGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACGGTGCTCACT GTGTGGTCGGCACCCAACTACTGCTACCGCTGTGGGAATGTGGCAGCCATCTTGGAGCTG GACGAGCATCTCCAGAAAGATTTCATCATCTTTGAGGCTGCTCCCCAAGAGACACGGGGC ATCCCCTCCAAGAAGCCCGTGGCCGACTACTTCCTGTGACCCCGCCCGGCCCCTGCCCCC TCCAACCCTTCTGGCCCTCGCACCACTGTGACTCTGCCATCTTCCTCAGACGGAGGCTGG GCGTGGGGGGGGCTGTCCTGGCTCTGCTGTCCCCCAAGAGGGTGCTTCGAGGGTGAGGAC TTCTCTGGAGAGGCCTGGAGACCTAGCTCCATGTTCCTCCTCCTCTCTCCCCACTTGAAC CATGAAGTTTCCAATAATTTTTTTTTCTTTTTTTCCTTCTTTTTTCTGTTTGTTTTTAGA TAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAA  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_002720 | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_002720.1, NP_002711.1 | 
| RefSeq Size | 1429 bp | 
| RefSeq ORF | 924 bp | 
| Locus ID | 5531 | 
| UniProt ID | P60510 | 
| Domains | Metallophos, PP2Ac | 
| Protein Families | Druggable Genome, Phosphatase | 
| Gene Summary | Protein phosphatase that is involved in many processes such as microtubule organization at centrosomes, maturation of spliceosomal snRNPs, apoptosis, DNA repair, tumor necrosis factor (TNF)-alpha signaling, activation of c-Jun N-terminal kinase MAPK8, regulation of histone acetylation, DNA damage checkpoint signaling, NF-kappa-B activation and cell migration. The PPP4C-PPP4R1 PP4 complex may play a role in dephosphorylation and regulation of HDAC3. The PPP4C-PPP4R2-PPP4R3A PP4 complex specifically dephosphorylates H2AFX phosphorylated on Ser-140 (gamma-H2AFX) generated during DNA replication and required for DNA double strand break repair. Dephosphorylates NDEL1 at CDK1 phosphorylation sites and negatively regulates CDK1 activity in interphase (By similarity). In response to DNA damage, catalyzes RPA2 dephosphorylation, an essential step for DNA repair since it allows the efficient RPA2-mediated recruitment of RAD51 to chromatin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC200538 | PPP4C (Myc-DDK-tagged)-Human protein phosphatase 4, catalytic subunit (PPP4C) | 
                                                     CNY 4465.00  | 
                                            |
| RC200538L1 | Lenti ORF clone of Human protein phosphatase 4, catalytic subunit (PPP4C), Myc-DDK-tagged | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4800.00  | 
                                            |
| RC200538L2 | Lenti ORF clone of Human protein phosphatase 4, catalytic subunit (PPP4C), mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC200538L3 | Lenti ORF clone of Human protein phosphatase 4, catalytic subunit (PPP4C), Myc-DDK-tagged | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4800.00  | 
                                            |
| RC200538L4 | Lenti ORF clone of Human protein phosphatase 4, catalytic subunit (PPP4C), mGFP tagged | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4800.00  | 
                                            |
| RG200538 | PPP4C (tGFP-tagged) - Human protein phosphatase 4, catalytic subunit (PPP4C) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4000.00  | 
                                            |
| SC118440 | PPP4C (untagged)-Human protein phosphatase 4, catalytic subunit (PPP4C) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 2400.00  | 
                                            
