CLIC3 (NM_004669) Human Untagged Clone

CAT#: SC320820

CLIC3 (untagged)-Human chloride intracellular channel 3 (CLIC3)



  "NM_004669" in other vectors (5)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal antibody to CLIC3 (chloride intracellular channel 3)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004669.2 GCGCCTGACCGCGGCAGCTCCCACCATGGCGGAGACCAAGCTCCAGCTGTTTGTCAAGGC
GAGTGAGGACGGGGAGAGCGTGGGTCACTGCCCCTCCTGCCAGCGGCTCTTCATGGTCCT
GCTCCTCAAGGGCGTACCTTTCACCCTCACCACGGTGGACACGCGCAGGTCCCCGGACGT
GCTGAAGGACTTCGCCCCCGGCTCGCAGCTGCCCATCCTGCTCTATGACAGCGACGCCAA
GACAGACACGCTGCAGATCGAGGACTTTCTGGAGGAGACGCTGGGGCCGCCCGACTTCCC
CAGCCTGGCGCCTCGTTACAGGGAGTCCAACACCGCCGGCAACGACGTTTTCCACAAGTT
CTCCGCGTTCATCAAGAACCCGGTGCCCGCGCAGGACGAAGCCCTGTACCAGCAGCTGCT
GCGCGCCCTCGCCAGGCTGGACAGCTACCTGCGCGCGCCCCTGGAGCACGAGCTGGCGGG
GGAGCCGCAGCTGCGCGAGTCCCGCCGCCGCTTCCTGGACGGCGACAGGCTCACGCTGGC
CGACTGCAGCCTCCTGCCCAAGCTGCACATCGTCGACACGGTGTGCGCGCACTTCCGCCA
GGCGCCCATCCCCGCGGAGCTGCGCGGCGTACGCCGCTACCTGGACAGCGCGATGCAGGA
GAAAGAGTTCAAATACACGTGTCCGCACAGCGCCGAGATCCTGGCGGCCTACCGGCCCGC
CGTGCACCCCCGCTAGCGCCCCACCCCGCGTCTGTCGCCCAATAAAGGCATCTTTGTCGT
GAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004669
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004669.2, NP_004660.2
RefSeq Size 813 bp
RefSeq ORF 711 bp
Locus ID 9022
UniProt ID O95833
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...