PSMA3 (NM_152132) Human Untagged Clone

CAT#: SC320835

PSMA3 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2



  "NM_152132" in other vectors (5)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PSMA3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HC8; PSC3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_152132.1 GCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCA
CTGGGTATGACCTGTCAGCCTCTACATTCTCTCCTGACGGAAGAGTTTTTCAAGTTGAAT
ATGCTATGAAGGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGCAAAGATGGTG
TTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAAA
GACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGTTGGCAGATGCTC
GTTCTTTAGCAGACATAGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTACA
ACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTGCATGCATATACACTCT
ACAGTGCTGTTAGACCTTTTGGCTGCAGTGTGAATGACGGTGCGCAACTCTACATGATTG
ACCCATCAGGTGTTTCATACGGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTG
CAAAGACGGAAATAGAGAAGCTTCAGATGAAAGAAATGACCTGCCGTGATATCGTTAAAG
AAGTTGCAAAAATAATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAG
AACTCAGCTGGGTTGGTGAATTAACTAATGGAAGACATGAAATTGTTCCAAAAGATATAA
GAGAAGAAGCAGAGAAATATGCTAAGGAATCTCTGAAGGAAGAAGATGAATCAGATGATG
ATAATATGTAACATTTACTCCAGCATCTATTGTATTTTAAATTTCTACTCCAGTCCAATG
TAACTATTTAGCCCTGGATTATACATACTGTCCAATTTTCATTAAATTTTTGTCTTATAA
CTATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_152132
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_152132.1, NP_687033.1
RefSeq Size 938 bp
RefSeq ORF 747 bp
Locus ID 5684
UniProt ID P25788
Domains proteasome
Protein Families Druggable Genome, Protease, Stem cell - Pluripotency
Protein Pathways Proteasome
Gene Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a shorter protein (isoform 2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...