SAT1 (NM_002970) Human Untagged Clone
CAT#: SC320861
SAT1 (untagged)-Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DC21; KFSD; KFSDX; SAT; SSAT; SSAT-1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002970.1
GCGCAGCTCTTAGTCGCGGGCCGACTGGTGTTTATCCGTCACTCGCCGAGGTTCCTTGGG
TCATGGTGCCAGCCTGACTGAGAAGAGGACGCTCCCGGGAGACGAATGAGGAACCACCTC CTCCTACTGTTCAAGTACAGGGGCCTGGTCCGCAAAGGGAAGAAAAGCAAAAGACGAAAA TGGCTAAATTCGTGATCCGCCCAGCCACTGCCGCCGACTGCAGTGACATACTGCGGCTGA TCAAGGAGCTGGCTAAATATGAATACATGGAAGAACAAGTAATCTTAACTGAAAAAGATC TGCTAGAAGATGGTTTTGGAGAGCACCCCTTTTACCACTGCCTGGTTGCAGAAGTGCCGA AAGAGCACTGGACTCCGGAAGGACACAGCATTGTTGGTTTTGCCATGTACTATTTTACCT ATGACCCGTGGATTGGCAAGTTATTGTATCTTGAGGACTTCTTCGTGATGAGTGATTATA GAGGCTTTGGCATAGGATCAGAAATTCTGAAGAATCTAAGCCAGGTTGCAATGAGGTGTC GCTGCAGCAGCATGCACTTCTTGGTAGCAGAATGGAATGAACCATCCATCAACTTCTATA AAAGAAGAGGTGCTTCTGATCTGTCCAGTGAAGAGGGTTGGAGACTGTTCAAGATCGACA AGGAGTACTTGCTAAAAATGGCAACAGAGGAGTGAGGAGTGCTGCTGTAGATGACAACCT CCATTCTATTTTAGAATAAATTCCCAACTTCTCTTGCTTTCTATGCTGTTTGTAGTGAAA TAATAGAATGAGCACCCATTCCAAAGCTTTATTACCAGTGGCGTTGTTGCATGTTTGAAA TGAGGTCTGTTTAAAGTGGCAATCTCAGATGCAGTTTGGAGAGTCAGATCTTTCTCCTTG AATATCTTTCGATAAACAACAAGGTGGTGTGATCTTAATATATTTGAAAAAAACTTCATT CTCGTGAGTCATTTAAATGTGTACAATGTACACACTGGTACTTAGAGTTTCTGTTTGATT CTTTTTTAATAAACTACTCTTTGATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002970 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002970.1, NP_002961.1 |
RefSeq Size | 1060 bp |
RefSeq ORF | 516 bp |
Locus ID | 6303 |
UniProt ID | P21673 |
Domains | Acetyltransf |
Protein Families | Druggable Genome |
Protein Pathways | Arginine and proline metabolism, Metabolic pathways |
Gene Summary | The protein encoded by this gene belongs to the acetyltransferase family, and is a rate-limiting enzyme in the catabolic pathway of polyamine metabolism. It catalyzes the acetylation of spermidine and spermine, and is involved in the regulation of the intracellular concentration of polyamines and their transport out of cells. Defects in this gene are associated with keratosis follicularis spinulosa decalvans (KFSD). Alternatively spliced transcripts have been found for this gene.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (1) represents the protein coding transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203275 | SAT1 (Myc-DDK-tagged)-Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1 |
CNY 3,600.00 |
|
RC203275L1 | Lenti ORF clone of Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC203275L2 | Lenti ORF clone of Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC203275L3 | Lenti ORF clone of Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC203275L4 | Lenti ORF clone of Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RG203275 | SAT1 (tGFP-tagged) - Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1 |
CNY 5,200.00 |
|
SC118307 | SAT1 (untagged)-Human spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 1 |
CNY 3,600.00 |