Plunc (BPIFA1) (NM_130852) Human Untagged Clone
CAT#: SC320871
BPIFA1 (untagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bA49G10.5; LUNX; NASG; PLUNC; SPLUNC1; SPURT |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_130852.1
GGGGGAGTGGGGGAGAGAGAGGAGACCAGGACAGCTGCTGAGACCTCTAAGAAGTCCAGA
TACTAAGAGCAAAGATGTTTCAAACTGGGGGCCTCATTGTCTTCTACGGGCTGTTAGCCC AGACCATGGCCCAGTTTGGAGGCCTGCCCGTGCCCCTGGACCAGACCCTGCCCTTGAATG TGAATCCAGCCCTGCCCTTGAGTCCCACAGGTCTTGCAGGAAGCTTGACAAATGCCCTCA GCAATGGCCTGCTGTCTGGGGGCCTGTTGGGCATTCTGGAAAACCTTCCGCTCCTGGACA TCCTGAAGCCTGGAGGAGGTACTTCTGGTGGCCTCCTTGGGGGACTGCTTGGAAAAGTGA CGTCAGTGATTCCTGGCCTGAACAACATCATTGACATAAAGGTCACTGACCCCCAGCTGC TGGAACTTGGCCTTGTGCAGAGCCCTGATGGCCACCGTCTCTATGTCACCATCCCTCTCG GCATAAAGCTCCAAGTGAATACGCCCCTGGTCGGTGCAAGTCTGTTGAGGCTGGCTGTGA AGCTGGACATCACTGCAGAAATCTTAGCTGTGAGAGATAAGCAGGAGAGGATCCACCTGG TCCTTGGTGACTGCACCCATTCCCCTGGAAGCCTGCAAATTTCTCTGCTTGATGGACTTG GCCCCCTCCCCATTCAAGGTCTTCTGGACAGCCTCACAGGGATCTTGAATAAAGTCCTGC CTGAGTTGGTTCAGGGCAACGTGTGCCCTCTGGTCAATGAGGTTCTCAGAGGCTTGGACA TCACCCTGGTGCATGACATTGTTAACATGCTGATCCACGGACTACAGTTTGTCATCAAGG TCTAAGCCTTCCAGGAAGGGGCTGGCCTCTGCTGAGCTGCTTCCCAGTGCTCACAGATGG CTGGCCCATGTGCTGGAAGATGACACAGTTGCCTTCTCTCCGAGGAACCTGCCCCCTCTC CTTTCCCACCAGGCGTGTGTAACATCCCATGTGCCTCACCTAATAAAATGGCTCTTCTTC TGCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_130852 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_130852.1, NP_570913.1 |
| RefSeq Size | 1094 bp |
| RefSeq ORF | 771 bp |
| Locus ID | 51297 |
| UniProt ID | Q9NP55 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene is the human homolog of murine plunc, and like the mouse gene, is specifically expressed in the upper airways and nasopharyngeal regions. The encoded antimicrobial protein displays antibacterial activity against Gram-negative bacteria. It is thought to be involved in inflammatory responses to irritants in the upper airways and may also serve as a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Multiple transcript variants resulting from alternative splicing in the 3' UTR have been detected, but the full-length nature of only three are known. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2) represents the longest transcript. All three variants encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203060 | BPIFA1 (Myc-DDK-tagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2 |
CNY 2400.00 |
|
| RC203060L1 | Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC203060L2 | Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC203060L3 | Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203060L4 | Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG203060 | BPIFA1 (tGFP-tagged) - Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2 |
CNY 4000.00 |
|
| SC305921 | BPIFA1 (untagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2 |
CNY 3990.00 |
