Granzyme A (GZMA) (NM_006144) Human Untagged Clone
CAT#: SC320921
GZMA (untagged)-Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA)
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CTLA3; HFSP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006144.2
CAGCCACAATGAGGAACTCCTATAGATTTCTGGCATCCTCTCTCTCAGTTGTCGTTTCTC
TCCTGCTAATTCCTGAAGATGTCTGTGAAAAAATTATTGGAGGAAATGAAGTAACTCCTC ATTCAAGACCCTACATGGTCCTACTTAGTCTTGACAGAAAAACCATCTGTGCTGGGGCTT TGATTGCAAAAGACTGGGTGTTGACTGCAGCTCACTGTAACTTGAACAAAAGGTCCCAGG TCATTCTTGGGGCTCACTCAATAACCAGGGAAGAGCCAACAAAACAGATAATGCTTGTTA AGAAAGAGTTTCCCTATCCATGCTATGACCCAGCCACACGCGAAGGTGACCTTAAACTTT TACAGCTGACGGAAAAAGCAAAAATTAACAAATATGTGACTATCCTTCATCTACCTAAAA AGGGGGATGATGTGAAACCAGGAACCATGTGCCAAGTTGCAGGGTGGGGCAGGACTCACA ATAGTGCATCTTGGTCCGATACTCTGAGAGAAGTCAATATCACCATCATAGACAGAAAAG TCTGCAATGATCGAAATCACTATAATTTTAACCCTGTGATTGGAATGAATATGGTTTGTG CTGGAAGCCTCCGAGGTGGAAGAGACTCGTGCAATGGAGATTCTGGAAGCCCTTTGTTGT GCGAGGGTGTTTTCCGAGGGGTCACTTCCTTTGGCCTTGAAAATAAATGCGGAGACCCTC GTGGGCCTGGTGTCTATATTCTTCTCTCAAAGAAACACCTCAACTGGATAATTATGACTA TCAAGGGAGCAGTTTAAATAACCGTTTCCTTTCATTTACTGTGGCTTCTTAATCTTTTCA CAAATAAAATCAATTTGCATGACTGTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006144 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006144.2, NP_006135.1 |
RefSeq Size | 878 bp |
RefSeq ORF | 789 bp |
Locus ID | 3001 |
UniProt ID | P12544 |
Domains | Tryp_SPc |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204852 | GZMA (Myc-DDK-tagged)-Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA) |
CNY 2400.00 |
|
RC204852L1 | Lenti ORF clone of Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA), Myc-DDK-tagged |
CNY 4800.00 |
|
RC204852L2 | Lenti ORF clone of Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA), mGFP tagged |
CNY 5890.00 |
|
RC204852L3 | Lenti ORF clone of Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA), Myc-DDK-tagged |
CNY 4800.00 |
|
RC204852L4 | Lenti ORF clone of Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA), mGFP tagged |
CNY 4800.00 |
|
RG204852 | GZMA (tGFP-tagged) - Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA) |
CNY 4000.00 |
|
SC116272 | GZMA (untagged)-Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA) |
CNY 2400.00 |
其它Granzyme A产品