TINP1 (NSA2) (NM_014886) Human Untagged Clone
CAT#: SC321061
NSA2 (untagged)-Human NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2)
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CDK105; HCL-G1; HCLG1; HUSSY-29; HUSSY29; TINP1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_014886.2
GACTCTTTCCTGTCCCGGCCTGCGTGGTGTGGGCTTGTGGGTCTTTGAGACCCGAAAATT
GAGAGCGTTTTCGCACTCCAGCGGCTGCTCCTGGCGGCTCTGCGGCCGTCACCATGCCAC AGAATGAATATATTGAATTACACCGTAAACGCTATGGATACCGTTTGGATTACCATGAGA AAAAGAGAAAGAAGGAAAGTCGAGAGGCTCATGAACGTTCAAAGAAGGCAAAGAAAATGA TTGGTCTGAAGGCTAAGCTTTACCATAAACAGCGTCATGCTGAGAAAATACAAATGAAAA AGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACACCAC AGGGAGCAGTACCTGCCTATCTGCTGGACAGAGAGGGACAATCTCGAGCTAAAGTACTTT CCAATATGATTAAACAGAAAAGAAAAGAGAAGGCGGGAAAATGGGAAGTCCCTCTGCCTA AAGTACGTGCCCAGGGAGAAACAGAAGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGA AGAAGGCATGGAAGAGAATGGTTACTAAAGTGTGCTTTGTTGGAGATGGCTTTACAAGAA AACCACCTAAATATGAAAGATTCATCAGGCCAATGGGCTTGCGTTTCAAGAAAGCCCATG TAACACATCCTGAACTGAAAGCCACCTTTTGCCTACCAATACTTGGTGTAAAGAAGAATC CCTCATCCCCACTGTATACAACTTTGGGTGTTATTACCAAAGGTACTGTCATTGAAGTAA ATGTGAGCGAATTGGGCCTTGTGACACAAGGAGGCAAAGTTATTTGGGGAAAATATGCCC AGGTTACCAACAATCCTGAAAATGATGGATGTATAAATGCAGTCTTACTGGTTTGACAGC AATTTCATATATAATTATTGAGGACTACACACCAATTGAAGAAACTGCCATTACTGTGAT GTTTCTGAATACTACCAAACAGCCATACATGTCTGCAATGAAGAGATTTATTAAATTGTA AACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_014886 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014886.2, NP_055701.1 |
| RefSeq Size | 1105 bp |
| RefSeq ORF | 783 bp |
| Locus ID | 10412 |
| UniProt ID | O95478 |
| Domains | Ribosomal_S8e |
| Gene Summary | This gene encodes a nucleolar protein involved in cell cycle regulation and proliferation. This gene was identified based on sequence similarity to a highly conserved Saccharomyces cerevisiae gene encoding a pre-ribosomal protein, which is involved in large ribosomal subunit biogenesis. The encoded protein is found at elevated levels in diabetic nephropathy. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202728 | NSA2 (Myc-DDK-tagged)-Human NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2) |
CNY 2400.00 |
|
| RC202728L3 | Lenti ORF clone of Human NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC202728L4 | Lenti ORF clone of Human NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2), mGFP tagged |
CNY 5890.00 |
|
| RG202728 | NSA2 (tGFP-tagged) - Human NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2) |
CNY 4000.00 |
|
| SC114735 | NSA2 (untagged)-Human NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2) |
CNY 2400.00 |
