BCA1 (CXCL13) (NM_006419) Human Untagged Clone
CAT#: SC321077
CXCL13 (untagged)-Human chemokine (C-X-C motif) ligand 13 (CXCL13)
CNY 1200.00
CNY 2950.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ANGIE; ANGIE2; BCA-1; BCA1; BLC; BLR1L; SCYB13 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>SC321077 representing NM_006419.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGTTCATCTCGACATCTCTGCTTCTCATGCTGCTGGTCAGCAGCCTCTCTCCAGTCCAAGGTGTT CTGGAGGTCTATTACACAAGCTTGAGGTGTAGATGTGTCCAAGAGAGCTCAGTCTTTATCCCTAGACGC TTCATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAG AAGAACAAGTCAATTGTGTGTGTGGACCCTCAAGCTGAATGGATACAAAGAATGATGGAAGTATTGAGA AAAAGAAGTTCTTCAACTCTACCAGTTCCAGTGTTTAAGAGAAAGATTCCCTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_006419 |
| Insert Size | 330 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006419.2 |
| RefSeq Size | 1219 bp |
| RefSeq ORF | 330 bp |
| Locus ID | 10563 |
| UniProt ID | O43927 |
| Domains | IL8 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| MW | 12.7 kDa |
| Gene Summary | B lymphocyte chemoattractant, independently cloned and named Angie, is an antimicrobial peptide and CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Oct 2014] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
RelA driven co-expression of CXCL13 and CXCR5 is governed by a multifaceted transcriptional program regulating breast cancer progression
,Biswas, S;Roy Chowdhury, S;Mandal, G;Purohit, S;Gupta, A;Bhattacharyya, A;,
Biochim Biophys Acta Mol Basis Dis
,PubMed ID 30553016
[BCA1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203102 | CXCL13 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 13 (CXCL13) |
CNY 1200.00 |
|
| RC203102L1 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC203102L2 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), mGFP tagged |
CNY 5890.00 |
|
| RC203102L3 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203102L4 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 13 (CXCL13), mGFP tagged |
CNY 5890.00 |
|
| RG203102 | CXCL13 (tGFP-tagged) - Human chemokine (C-X-C motif) ligand 13 (CXCL13) |
CNY 2800.00 |
