SPANX (SPANXC) (NM_022661) Human Untagged Clone
CAT#: SC321127
SPANXC (untagged)-Human SPANX family, member C (SPANXC)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT11.3; CTp11; SPANX-C; SPANX-E; SPANXE |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_022661 edited
GAATTCGGCCATTACGGCCGGGGGCGAAGATTCAAAACCTACAAAAGCCTGCCGCAGACA TTGAAGAACCAATATATACAATGGACAAACAATCCAGTGCCGGCGGGGTGAAGAGGAGCG TCCCCTGTGAATCCAACGAGGTGAATGAGACGATGCCGGAGACCCCAACTGGGGACTCAG ACCCGCAACCTGCTCCTAAAAAAATGAAAACATCTGAGTCCTCGACCATACTAGTGGTTC GCTACAGGAGGAACGTGAAAAGAACATCTCCAGAGGAACTGCTGAATGACCACGCCCGAG AGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATGGAAATAATGGTTGAAA TACCTGCAAAGTAGCAAGAAGCTACATCTCTCAACCTTGGGCAATGAAAATAAAGTTTGA GAAGCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATGTCGGCCGCCTCGGCCCTCG ACTCT |
Restriction Sites | Please inquire |
ACCN | NM_022661 |
Insert Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | It was fully sequenced and the DNA sequence matches with that of NM_022661.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022661.2, NP_073152.1 |
RefSeq Size | 425 bp |
RefSeq ORF | 294 bp |
Locus ID | 64663 |
UniProt ID | Q9NY87 |
Gene Summary | Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family, which is located in a gene cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a protein that localizes to the nucleus and is expressed in highly metastatic cell lines, making the protein a potential diagnostic and prognostic marker. The protein belongs to a family of cancer/testis antigens and represents a potential target for cancer immunotherapy. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208858 | SPANXC (Myc-DDK-tagged)-Human SPANX family, member C (SPANXC) |
CNY 1200.00 |
|
RC208858L3 | Lenti-ORF clone of SPANXC (Myc-DDK-tagged)-Human SPANX family, member C (SPANXC) |
CNY 5890.00 |
|
RC208858L4 | Lenti-ORF clone of SPANXC (mGFP-tagged)-Human SPANX family, member C (SPANXC) |
CNY 5890.00 |
|
RG208858 | SPANXC (tGFP-tagged) - Human SPANX family, member C (SPANXC) |
CNY 4370.00 |
|
SC305042 | SPANXC (untagged)-Human SPANX family, member C (SPANXC) |
CNY 1200.00 |