SERPINB6 (NM_004568) Human Untagged Clone
CAT#: SC321547
SERPINB6 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1
CNY 3656.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004568.4
GATTCTCCGGGATATTACCGGAGACGGAGTGTTTTATTATTAGCCTTTCTTAGGTGGACA
TTTCCATTTGAATTACAAGTCCTTTAGGCTGGGCGTGGTGCATGGCTGTAATCTCAGCAC CTTGGGAGGCTGAGGCAGGAAGATCACTTGAGGCCAGGCGTTGGAGAGCAGCCTGGGCAA GGTGGCAAGAACCTTGTCTCTACAAAAAAAAAAGCGTCTGCCATCATGGATGTTCTCGCA GAAGCAAATGGCACCTTTGCCTTAAACCTTTTGAAAACGCTGGGTAAAGACAACTCGAAG AATGTGTTTTTCTCACCCATGAGCATGTCCTGTGCCCTGGCCATGGTCTACATGGGGGCA AAGGGAAACACCGCTGCACAGATGGCCCAGATACTTTCTTTCAATAAAAGTGGCGGTGGT GGAGACATCCACCAGGGCTTCCAGTCTCTTCTCACCGAAGTGAACAAGACTGGCACGCAG TACTTGCTTAGGGTGGCCAACAGGCTCTTTGGGGAAAAGTCTTGTGATTTCCTCTCATCT TTTAGAGATTCCTGCCAAAAATTCTACCAAGCAGAGATGGAGGAGCTTGACTTTATCAGC GCCGTAGAGAAGTCCAGAAAACACATAAACACCTGGGTAGCTGAAAAGACAGAAGGTAAA ATTGCGGAGTTGCTCTCTCCGGGCTCAGTGGATCCATTGACAAGGCTGGTTCTGGTGAAT GCTGTCTATTTCAGAGGAAACTGGGATGAACAGTTTGACAAGGAGAACACCGAGGAGAGA CTGTTTAAAGTCAGCAAGAATGAGGAGAAACCTGTGCAAATGATGTTTAAGCAATCTACT TTTAAGAAGACCTATATAGGAGAAATATTTACCCAAATCTTGGTGCTTCCATATGTTGGC AAGGAACTGAATATGATCATCATGCTTCCGGACGAGACCACTGACTTGAGAACGGTGGAG AAAGAACTCACTTACGAGAAGTTCGTAGAATGGACGAGGCTGGACATGATGGATGAAGAG GAGGTGGAAGTGTCCCTCCCGCGGTTTAAACTAGAGGAAAGCTACGACATGGAGAGTGTC CTGCGCAACCTGGGCATGACTGATGCCTTCGAGCTGGGCAAGGCAGACTTCTCTGGAATG TCCCAGACAGACCTGTCTCTGTCCAAGGTCGTGCACAAGTCTTTTGTGGAGGTCAATGAG GAAGGCACGGAGGCTGCAGCCGCCACAGCTGCCATCATGATGATGCGGTGTGCCAGATTC GTCCCCCGCTTCTGCGCCGACCACCCCTTCCTTTTCTTCATCCAGCACAGCAAGACCAAC GGGATTCTCTTCTGCGGCCGCTTTTCCTCTCCGTGAGGACAGGGCAGTCTTGGTGTGCAG CCCCTCTCCTCTCTGTCCCCTGACACTCCACAGTGTGCCTGCAACCCAAGTGGCCTTATC CGTGCAGTGGTGGCAGTTCAGAAATAAAGGGCCCATTTGTGGGATGCCGCATTCAAAAAA AAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004568 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004568.4, NP_004559.4 |
| RefSeq Size | 1665 bp |
| RefSeq ORF | 1131 bp |
| Locus ID | 5269 |
| UniProt ID | P35237 |
| Domains | SERPIN |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010] Transcript Variant: This variant (1) represents the predominant transcript. Variants 1, 5, 6, 7 and 8 encode the same isoform (a). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A Truncating Mutation in SERPINB6 Is Associated with Autosomal-Recessive Nonsyndromic Sensorineural Hearing Loss
,null,
American Journal of Human Genetics
,PubMed ID 20451170
[SERPINB6]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200668 | SERPINB6 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1 |
CNY 3656.00 |
|
| RC200668L1 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1, Myc-DDK-tagged |
CNY 6056.00 |
|
| RC200668L2 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC200668L3 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC200668L4 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG200668 | SERPINB6 (tGFP-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 1 |
CNY 4370.00 |
其它SERPINB6产品
