DPH3 (NM_206831) Human Untagged Clone

CAT#: SC321622

DPH3 (untagged)-Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 1



  "NM_206831" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DELGIP; DELGIP1; DESR1; DPH3A; KTI11; ZCSL2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_206831.1 GGCACGAGGCCTTCGGCCACCCCCGCTGACCATGGCAGTGTTTCATGACGAGGTGGAAAT
CGAGGACTTCCAATATGACGAGGACTCGGAGACGTATTTCTATCCCTGCCCATGTGGAGA
TAACTTCTCCATCACCAAGGAAGATTTGGAGAATGGGGAAGACGTGGCAACGTGTCCTAG
CTGCTCTCTCATTATAAAAGTGATTTATGACAAAGATCAGTTTGTGTGTGGAGAAACAGT
CCCAGCCCCTTCAGCCAACAAAGAATTAGTTAAATGCTGAAGAAGCCTTCAGGAATCCAA
ATCCTGAACATTTGGAATGAGCCCAGATAGAAATATCGAATGCAAAGCTACTGGCTTCAC
AGAGACAACCATTTATGATTTGCTGTTCTGTAAGAGTGTGGATTCTTTCTATCAACTGCT
GATATCATCTTCAGGAAGCAAGTCCATAACATGACATATCTGGATTTTGTGCTTAGAACC
TTAAATTGGAAGCATTCTTAATTATGCATCTAAATTTAAAAGAAGATAATTTCAAAACAG
TAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_206831
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_206831.1, NP_996662.1
RefSeq Size 549 bp
RefSeq ORF 249 bp
Locus ID 285381
UniProt ID Q96FX2
Gene Summary This gene encodes a CSL zinc finger-containing protein that is required for dipthamide biosynthesis. The encoded protein is necessary for the initial step in the modification of a histidine residue in elongation factor-2 to diphthamide. This modified residue is a target for ADP ribosylation by the bacterial toxins diphtheria toxin and Pseudomonas exotoxin A. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...