BXDC1 (RPF2) (NM_032194) Human Untagged Clone
CAT#: SC321658
RPF2 (untagged)-Human ribosome production factor 2 homolog (S. cerevisiae) (RPF2)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bA397G5.4; BXDC1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_032194.1
GTTGCAGGTAGCGGTAGCGATGGACACTCTGGATCGAGTAGTAAAGCCCAAAACGAAAAG
AGCCAAGAGATTCCTTGAGAAGAGAGAACCGAAACTCAATGAAAATATTAAAAATGCCAT GCTGATTAAAGGGGGAAATGCAAATGCAACAGTGACAAAAGTACTTAAAGATGTGTATGC ACTGAAAAAACCATACGGTGTACTATATAAAAAGAAAAATATTACAAGACCTTTTGAGGA TCAGACATCACTGGAATTCTTTTCAAAGAAGTCAGATTGTTCTTTATTCATGTTTGGCTC CCATAATAAGAAGCGGCCAAATAATCTAGTAATAGGTCGTATGTATGACTACCATGTGCT GGATATGATTGAATTAGGTATTGAGAATTTTGTCTCTCTAAAAGACATTAAGAACAGTAA ATGTCCTGAGGGAACAAAACCCATGCTGATATTTGCTGGCGATGATTTCGATGTAACAGA AGATTATAGAAGACTAAAAAGTCTTCTTATTGATTTCTTCAGAGGCCCCACAGTATCAAA TATCCGCCTGGCTGGATTAGAGTATGTTCTGCACTTCACTGCACTGAATGGGAAGATTTA CTTTCGAAGCTATAAGTTGCTGTTGAAGAAATCTGGTTGCAGAACACCACGGATTGAATT GGAAGAGATGGGACCCTCATTGGATCTGGTTCTGAGGAGGACACACCTGGCATCGGATGA CCTTTATAAATTATCTATGAAAATGCCAAAAGCTCTCAAGCCAAAGAAGAAGAAAAATAT TTCCCATGATACTTTTGGTACAACTTATGGAAGGATTCATATGCAGAAGCAAGACCTAAG CAAACTACAAACCAGGAAAATGAAGGGGTTGAAGAAGCGACCTGCAGAAAGGATAACAGA AGACCACGAGAAAAAGTCAAAAAGAATTAAAAAAAATTGATGGAACTTAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_032194 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032194.1, NP_115570.1 |
| RefSeq Size | 1078 bp |
| RefSeq ORF | 921 bp |
| Locus ID | 84154 |
| UniProt ID | Q9H7B2 |
| Gene Summary | Involved in ribosomal large subunit assembly. May regulate the localization of the 5S RNP/5S ribonucleoprotein particle to the nucleolus.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204393 | RPF2 (Myc-DDK-tagged)-Human ribosome production factor 2 homolog (S. cerevisiae) (RPF2) |
CNY 2400.00 |
|
| RC204393L3 | Lenti ORF clone of Human ribosome production factor 2 homolog (S. cerevisiae) (RPF2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204393L4 | Lenti ORF clone of Human ribosome production factor 2 homolog (S. cerevisiae) (RPF2), mGFP tagged |
CNY 5890.00 |
|
| RG204393 | RPF2 (tGFP-tagged) - Human ribosome production factor 2 homolog (S. cerevisiae) (RPF2) |
CNY 4000.00 |
