MBD2 (NM_003927) Human Untagged Clone
CAT#: SC321741
MBD2 (untagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1
CNY 5488.00
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | DMTase; NY-CO-41 | 
| Vector | pCMV6-AC | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >OriGene sequence for NM_003927.3
CCACGCGTCCGCCGGGATTCCAAGGGCTCGGTTACGGAAGAAGCGCAGCGCCGGCTGGGG 
AGGGGGCTGGATGCGCGCGCACCCGGGGGGAGGCCGCTGCTGCCCGGAGCAGGAGGAGGG GGAGAGTGCGGCGGGCGGCAGCGGCGCTGGCGGCGACTCCGCCATAGAGCAGGGGGGCCA GGGCAGCGCGCTCGCCCCGTCCCCGGTGAGCGGCGTGCGCAGGGAAGGCGCTCGGGGCGG CGGCCGTGGCCGGGGGCGGTGGAAGCAGGCGGGCCGGGGCGGCGGCGTCTGTGGCCGTGG CCGGGGCCGGGGCCGTGGCCGGGGACGGGGACGGGGCCGGGGCCGGGGCCGCGGCCGTCC CCCGAGTGGCGGCAGCGGCCTTGGCGGCGACGGCGGCGGCTGCGGCGGCGGCGGCAGCGG TGGCGGCGGCGCCCCCCGGCGGGAGCCGGTCCCTTTCCCGTCGGGGAGCGCGGGGCCGGG GCCCAGGGGACCCCGGGCCACGGAGAGCGGGAAGAGGATGGATTGCCCGGCCCTCCCCCC CGGATGGAAGAAGGAGGAAGTGATCCGAAAATCTGGGCTAAGTGCTGGCAAGAGCGATGT CTACTACTTCAGTCCAAGTGGTAAGAAGTTCAGAAGCAAGCCTCAGTTGGCAAGGTACCT GGGAAATACTGTTGATCTCAGCAGTTTTGACTTCAGAACTGGAAAGATGATGCCTAGTAA ATTACAGAAGAACAAACAGAGACTGCGAAACGATCCTCTCAATCAAAATAAGGGTAAACC AGACTTGAATACAACATTGCCAATTAGACAAACAGCATCAATTTTCAAACAACCGGTAAC CAAAGTCACAAATCATCCTAGTAATAAAGTGAAATCAGACCCACAACGAATGAATGAACA GCCACGTCAGCTTTTCTGGGAGAAGAGGCTACAAGGACTTAGTGCATCAGATGTAACAGA ACAAATTATAAAAACCATGGAACTACCCAAAGGTCTTCAAGGAGTTGGTCCAGGTAGCAA TGATGAGACCCTTTTATCTGCTGTTGCCAGTGCTTTGCACACAAGCTCTGCGCCAATCAC AGGGCAAGTCTCCGCTGCTGTGGAAAAGAACCCTGCTGTTTGGCTTAACACATCTCAACC CCTCTGCAAAGCTTTTATTGTCACAGATGAAGACATCAGGAAACAGGAAGAGCGAGTACA GCAAGTACGCAAGAAATTGGAAGAAGCACTGATGGCAGACATCTTGTCGCGAGCTGCTGA TACAGAAGAGATGGATATTGAAATGGACAGTGGAGATGAAGCCTAAGAATATGATCAGGT AACTTTCGACCGACTTTCCCCAAGAGAAAATTCCTAGAAATTGAACAAAAATGTTTCCAC TGGCTTTTGCCTGTAAGAAAAAAAATGTACCCGAGCACATAGAGCTTTTTAATAGCACTA ACCAATGCCTTTTTAGATGTATTTTTGATGTATATATCTATTATTCAAAAAATCATGTTT ATTTTGAGTCCTAGGACTTAAAATTAGTCTTTTGTAATATCAAGCAGGACCCTAAGATGA AGCTGAGCTTTTGATGCCAGGTGCAATCTACTGGAAATGTAGCACTTACGTAAAACATTT GTTTCCCCCACAGTTTTAATAAGAACAGATCAGGAATTCTAAATAAATTTCCCAGTTAAA GATTATTGTGACTTCACTGTATATAAACATATTTTTATACTTTATTGAAAGGGGACACCT GTACATTCTTCCATCATCACTGTAAAGACAAATAAATGATTATATTCACAAAAAAAAAAA AAAA  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_003927 | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_003927.3, NP_003918.1 | 
| RefSeq Size | 2584 bp | 
| RefSeq ORF | 1236 bp | 
| Locus ID | 8932 | 
| UniProt ID | Q9UBB5 | 
| Domains | MBD | 
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors | 
| Gene Summary | DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC207511 | MBD2 (Myc-DDK-tagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 | 
                                                     CNY 5488.00  | 
                                            |
| RC207511L1 | Lenti-ORF clone of MBD2 (Myc-DDK-tagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 | 
                                                     CNY 7888.00  | 
                                            |
| RC207511L2 | Lenti-ORF clone of MBD2 (mGFP-tagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 | 
                                                     CNY 7888.00  | 
                                            |
| RC207511L3 | Lenti-ORF clone of MBD2 (Myc-DDK-tagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 | 
                                                     CNY 5890.00  | 
                                            |
| RC207511L4 | Lenti-ORF clone of MBD2 (mGFP-tagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 | 
                                                     CNY 5890.00  | 
                                            |
| RG207511 | MBD2 (tGFP-tagged) - Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 1 | 
                                                     CNY 4370.00  | 
                                            
