PILRB (NM_013440) Human Untagged Clone
CAT#: SC321885
PILRB (untagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1
CNY 2400.00
CNY 3990.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FDFACT1; FDFACT2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_013440.3
GGAAGTCTCCACCCCTGGGAGGCAGAAGCCAGGCATAGCGCGCTGGCTAGGACTCCAGTA
CCGTGAAGGGAGGCAGTGAGAGCAGACATCTGTGCCTCATTCCTGATCTCAAGGGGAAAG CAAGAACAAGGGAGGCTTCCTCAGGATCTCGAACCTGCGGAAGGAGGACCAGTCTGTGTA CTTCTGCCAAGTCCAGCTGGACATACAGATCAGGGAGGCTGTCGTGGCAGTCCATCAAGG GGACCCACCTCACCATCACCCAGGCCCTCAGGCAGCCCCTCCACAGGGCCCCTCTCCTGC CTGGACAGCTCTGCTGGTCTCCCCGTCCCCTGGAGAAGAACAAGGCCATGGGTCGGCCCC TGCTGCTGCCCCTGCTGCTCCTGCTGCAGCCGCCAGCATTTCTGCAGCCTGGTGGCTCCA CAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCA TGGGTGGCTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCATAGTTC CCAACGTGAGAATATCCTGGAGACGGGGCCACTTCCACGGGCAGTCCTTCTACAGCACAA GGCCGCCTTCCATTCACAAGGATTATGTGAACCGGCTCTTTCTGAACTGGACAGAGGGTC AGGAGAGCGGCTTCCTCAGGATCTCAAACCTGCGGAAGGAGGACCAGTCTGTGTATTTCT GCCGAGTCGAGCTGGACACCCGGAGATCAGGGAGGCAGCAGTTGCAGTCCATCAAGGGGA CCAAACTCACCATCACCCAGGCTGTCACAACCACCACCACCTGGAGGCCCAGCAGCACAA CCACCATAGCCGGCCTCAGGGTCACAGAAAGCAAAGGGCACTCAGAATCATGGCACCTAA GTCTGGACACTGCCATCAGGGTTGCATTGGCTGTCGCTGTGCTCAAAACTGTCATTTTGG GACTGCTGTGCCTCCTCCTCCTGTGGTGGAGGAGAAGGAAAGGTAGCAGGGCGCCAAGCA GTGACTTCTGACCAACAGAGTGTGGGGAGAAGGGATGTGTATTAGCCCCGGAGGACGTGA TGTGAGACCCGCTTGTGAGTCCTCCACACTCGTTCCCCATTGGCAAGATACATGGAGAGC ACCCTGAGGACCTTTAAAAGGCAAAGCCGCAAGGCAGAAGGAGGCTGGGTCCCTGAATCA CCGACTGGAGGAGAGTTACCTACAAGAGCCTTCATCCAGGAGCATCCACACTGCAATGAT ATAGGAATGAGGTCTGAACTCCACTGAATTAAACCACTGGCATTTGGGGGCTGTTTATTA TAGCAGTGCAAAGAGTTCCTTTATCCTCCCCAAGGATGGAAAAATACAATTTATTTTGCT TACCATACACCCCTTTTCTCCTCGTCCACATTTTCCAATCTGTATGGTGGCTGTCTTCTA TGGCAGAAGGTTTTGGGGAATAAATAGCGTGAAATGCTAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_013440 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013440.3, NP_038468.3 |
| RefSeq Size | 3632 bp |
| RefSeq ORF | 684 bp |
| Locus ID | 29990 |
| Domains | IG |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 3 encode the same isoform (a). |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The Ig-Like V-Type Domain of Paired Ig-Like Type 2 Receptor Alpha Is Critical for Herpes Simplex Virus Type 1-Mediated Membrane Fusion
,Qing Fan and Richard Longnecker,
J. Virol., Sep 2010; 84: 8664 - 8672
[PILRB]
|
|
The Ig-like V-type domain of PILR{alpha} is critical for HSV-1-mediated membrane fusion
,Qing Fan and Richard Longnecker,
J. Virol., Jun 2010; 10.1128/JVI.01039-10
[PILRB]
|
|
The Ig-Like V-Type Domain of Paired Ig-Like Type 2 Receptor Alpha Is Critical for Herpes Simplex Virus Type 1-Mediated Membrane Fusion ▿
,null,
Journal of Virology
,PubMed ID 20573830
[PILRB]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208515 | PILRB (Myc-DDK-tagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1 |
CNY 2400.00 |
|
| RC208515L1 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC208515L2 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC208515L3 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC208515L4 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG208515 | PILRB (tGFP-tagged) - Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 1 |
CNY 4000.00 |
