Glutathione S Transferase alpha 1 (GSTA1) (NM_145740) Human Untagged Clone
CAT#: SC321900
GSTA1 (untagged)-Human glutathione S-transferase alpha 1 (GSTA1)
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GST-epsilon; GST2; GSTA1-1; GTH1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_145740.2
GTGACAGCGTTTAACAAAGCTTAGAGAAACCTCCAGGAGACTGCTATCATGGCAGAGAAG
CCCAAGCTCCACTACTTCAATGCACGGGGCAGAATGGAGTCCACCCGGTGGCTCCTGGCT GCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTA AGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAG CTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAA GACATAAAGGAGAGAGCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAA ATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATC AAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGA CAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGTGGAACTTCTC TACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTG AAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGG AAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTTTAATAA CGCAGTCATGGAGGCCAAGAACTTGCAATACCAATGTTCTAAAGTTTTGCAACAATAAAG TACTTTACCTAAGTGTTGATTGTGCCTGTTGTGAAGCTAATGAACTCTTTCAAATTATAT GCTAATTAAATAATACAACTCCTATTCGCTGACTTAGTTAAAATTGATTTGTTTTCATTA GGATCTGATGTGAATTCAGATTTCCAATCTTCTCCTAGCCAACCATTTTCCTGGAATTAA AAATTCAGTAAAAAAGGAAACTATAGATTATGTGGTTTGTTTGACTTTTCCAAGAATTGT CCCGTAACATACAATGTGTCATACAATCTATTAAAATGTCAATGTAGAAATGCACTTCTG ACATTTTCAGGTATGCACAGGAGAAGAGTTACCATCCTGGATAATGGCATAAAGACATTT TCTTCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_145740 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145740.2, NP_665683.1 |
| RefSeq Size | 1046 bp |
| RefSeq ORF | 669 bp |
| Locus ID | 2938 |
| UniProt ID | P08263 |
| Domains | GST_N, GST_C |
| Protein Families | Druggable Genome |
| Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
| Gene Summary | This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) represents the longer transcript and encode the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208750 | GSTA1 (Myc-DDK-tagged)-Human glutathione S-transferase alpha 1 (GSTA1) |
CNY 2400.00 |
|
| RC208750L3 | Lenti ORF clone of Human glutathione S-transferase alpha 1 (GSTA1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC208750L4 | Lenti ORF clone of Human glutathione S-transferase alpha 1 (GSTA1), mGFP tagged |
CNY 5890.00 |
|
| RG208750 | GSTA1 (tGFP-tagged) - Human glutathione S-transferase alpha 1 (GSTA1) |
CNY 4000.00 |
其它Glutathione S Transferase alpha 1产品
