THOC7 (NM_025075) Human Untagged Clone
CAT#: SC321996
THOC7 (untagged)-Human THO complex 7 homolog (Drosophila) (THOC7)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | fSAP24; hTREX30; NIF3L1BP1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC321996
GCCATGGGAGCCGTGACTGACGACGAAGTTATACGGAAGCGTCTCCTCATTGATGGAGAT
GGTGCTGGAGATGATCGGAGAATTAATCTGCTAGTGAAGAGTTTCATTAAATGGTGCAAC TCTGGGTCCCAGGAAGAGGGATATAGCCAGTACCAACGTATGCTGAGCACGCTGTCTCAA TGTGAATTTTCAATGGGCAAAACTTTACTAGTATATGATATGAATCTCAGAGAAATGGAA AATTATGAAAAAATTTACAAGGAAATAGAATGTAGCATAGCTGGAGCACATGAAAAAATT GCTGAGTGCAAAAAGCAAATTCTTCAAGCAAAACGAATACGAAAAAATCGCCAAGAATAT GATGCTTTGGCAAAAGTGATTCAGCACCATCCAGACAGGCATGAGACATTAAAGGAACTA GAGGCTCTGGGAAAAGAATTAGAGCATCTTTCACACATTAAAGAAAGTGTTGAAGATAAG CTGGAATTGAGACGGAAACAGTTTCATGTTCTTCTTAGTACCATCCATGAACTTCAGCAA ACATTGGAAAATGATGAAAAACTCTCAGAGGTAGAAGAAGCTCAGGAAGCAAGCATGGAA ACAGATCCTAAGCCATAGACAGGCTAATTGCCCACCACTCCCAGGAATATTGAAATAGCT ACATGACCATAATGTGTTTAAAATGTGGTATGCTCTTGAGATATTTAAAGTTTTGGCAGT AAAATACTCTGTTTTTAAGTATGAATGTATTTCATTCATATTTCCTCTCACAAAGGAAAA TGACTTCAGTATAGATTTGTTTTTATTAAAATGCATTTTTTATTCTTAAGTGGTAGGAAG CAACATCCAAAAATGCTTAATAAAATGCTTTTAAGCTGCAAAAAAAAAAAAAAAAAAAAA AAA |
| Restriction Sites | Please inquire |
| ACCN | NM_025075 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_025075.1, NP_079351.1 |
| RefSeq Size | 963 bp |
| RefSeq ORF | 615 bp |
| Locus ID | 80145 |
| UniProt ID | Q6I9Y2 |
| Gene Summary | Required for efficient export of polyadenylated RNA. Acts as component of the THO subcomplex of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and which specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NFX1 pathway.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209500 | THOC7 (Myc-DDK-tagged)-Human THO complex 7 homolog (Drosophila) (THOC7) |
CNY 2400.00 |
|
| RC209500L3 | Lenti ORF clone of Human THO complex 7 homolog (Drosophila) (THOC7), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC209500L4 | Lenti ORF clone of Human THO complex 7 homolog (Drosophila) (THOC7), mGFP tagged |
CNY 5890.00 |
|
| RG209500 | THOC7 (tGFP-tagged) - Human THO complex 7 homolog (Drosophila) (THOC7) |
CNY 4000.00 |
