EXOSC1 (NM_016046) Human Untagged Clone

CAT#: SC322121

EXOSC1 (untagged)-Human exosome component 1 (EXOSC1)



  "NM_016046" in other vectors (7)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
EXOSC1 mouse monoclonal antibody, clone OTI1H9 (formerly 1H9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-108; CSL4; Csl4p; p13; PCH1F; SKI4; Ski4p
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322121 GGCAATCATGGCGCCACCTGTGAGATACTGCATCCCCGGCGAACGTCTGTGTAACTTGGA
GGAGGGCAGCCCGGGCAGCGGCACCTACACCCGCCACGGCTACATCTTTTCGTCGCTTGC
CGGCTGTCTGATGAAGAGCAGCGAGAATGGCGCGCTTCCAGTGGTGTCTGTAGTGAGAGA
AACAGAGTCCCAGTTACTGCCAGATGTGGGAGCTATTGTAACCTGTAAGGTCTCTAGCAT
CAATTCACGCTTTGCCAAAGTACACATCCTGTATGTGGGGTCCATGCCTCTTAAGAACTC
TTTTCGAGGAACTATCCGCAAGGAAGATGTCCGAGCAACTGAAAAAGACAAGGTTGAAAT
TTATAAGAGTTTCCGCCCAGGTGACATTGTCTTGGCCAAAGTGATCTCCTTAGGTGATGC
ACAGTCCAACTACCTGCTAACCACCGCCGAGAACGAGCTGGGAGTGGTGGTAGCCCACAG
TGAGTCAGGTATCCAGATGGTTCCCATCAGCTGGTGTGAGATGCAGTGCCCTAAGACCCA
CACTAAAGAATTCCGGAAAGTAGCCCGAGTACAACCCGAATTCTTGCAGACCTAAGAAGC
CACTTTTTACCCTATGGAAGGGGGTAAGCTGTTCCTGAGTATAACACCAAGATGCTGCTG
TCTTTATTCAAACACCTGGCGTCGGCCAACAGCCACTTCCAGAAAAATCTTCCAGTTTAC
GCTGTAGATGGAACATGTTTCTGTGAACCTATCAGTGGATTTCATTCTCTTGAGTAATAA
ATCTTATCTTTTCAAGACAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_016046
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016046.3, NP_057130.1
RefSeq Size 1150 bp
RefSeq ORF 588 bp
Locus ID 51013
UniProt ID Q9Y3B2
Protein Pathways RNA degradation
Gene Summary This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...