PPP1R7 (NM_002712) Human Untagged Clone
CAT#: SC322184
PPP1R7 (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7)
CNY 3656.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SDS22 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322184
GAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGATGG
AGGTTGACAGGCGGGTCGAGTCTGAAGAATCCGGCGATGAAGAAGGGAAGAAACACAGCA GTGGCATCGTGGCCGACCTCAGTGAACAGAGCCTGAAGGATGGGGAGGAGCGGGGGGAGG AGGACCCAGAAGAAGAACATGAGCTGCCTGTGGACATGGAAACCATCAACCTGGACAGAG ATGCAGAGGATGTTGATTTGAATCACTATCGCATAGGGAAGATTGAAGGATTTGAGGTAC TGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAATTAAATGCATTGAGAATCTGG AGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAAGAAGATTGAGA ATCTGGAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAACA TCGAAGGGGTTGACAAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCA GTAAAATTGAGAACTTAAGCAACTTACATCAACTACAGATGCTAGAGCTGGGATCTAACC GCATCCGGGCAATCGAAAATATCGACACCTTAACCAACCTGGAGAGTTTGTTTTTGGGGA AAAACAAAATTACTAAACTTCAGAACCTGGATGCGCTCACCAACCTGACAGTCCTCAGTA TGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGAACCTGGTGAACCTGCGGGAGC TGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAATAACAAACTCA CGATGTTGGACATTGCATCAAATAGAATCAAAAAGATTGAAAATATCAGCCATCTAACAG AGCTGCAAGAGTTCTGGATGAACGACAATCTCCTTGAGAGCTGGAGCGACCTCGACGAGC TGAAGGGAGCCAGGAGCCTGGAGACAGTGTACCTGGAGCGGAACCCCTTGCAGAAGGACC CCCAGTACCGGCGGAAGGTCATGCTCGCCCTCCCCTCCGTGCGGCAGATCGATGCCACGT TCGTCAGGTTCTGAGTCCTTCTTGGCTCCTCATGTGGTCCCTCTCCTCGGAAGAACTGCC CAGCCACGGGTTTTTAACCCACCTGTTGCTCCTGAGGTCGTCACTATATCAACAGTCACA AACCCAATGGCAATAAAGGCACTGACGATAGCTGGCGCGCGTGACGCCACACACCATTTT CAGATGCCGTTGCAATTAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002712 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002712.1, NP_002703.1 |
| RefSeq Size | 1299 bp |
| RefSeq ORF | 1083 bp |
| Locus ID | 5510 |
| UniProt ID | Q15435 |
| Domains | LRR, LRR_TYP, LRRcap, LRR_SD22 |
| Protein Families | Druggable Genome, Phosphatase |
| Gene Summary | This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as sds22alpha1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201634 | PPP1R7 (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7) |
CNY 3656.00 |
|
| RC201634L1 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC201634L2 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), mGFP tagged |
CNY 5890.00 |
|
| RC201634L3 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC201634L4 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), mGFP tagged |
CNY 6056.00 |
|
| RG201634 | PPP1R7 (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7) |
CNY 5256.00 |
|
| SC108479 | PPP1R7 (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7) |
CNY 3656.00 |
