SPCS1 (NM_014041) Human Untagged Clone
CAT＃: SC322217
SPCS1 (untagged)-Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HSPC033; SPC1; SPC12; YJR010C-A |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322217
GGCTACTGACGCGCAGTGCCAGACCTTAGCCCTCACGGTCCTTAAGTCTCGGTCGCCCTC
GCCTCGCAGCCTGCCACCCGCGCTCAGCTGCCCGCCTCCTCAGCCAGCCATGCTGGAGCA TCTGAGCTCGCTGCCCACGCAGATGGATTACAAGGGCCAGAAGCTAGCTGAACAGATGTT TCAGGGAATTATTCTTTTTTCTGCAATAGTTGGATTTATCTACGGGTACGTGGCTGAACA GTTCGGGTGGACTGTCTATATAGTTATGGCCGGATTTGCTTTTTCATGTTTGGCCCAGCT GACACTTCCTCCATGGCCCATCTATCGCCGGCATCCTCTCAAGTGGTTACCTGTTCAAGA ATCAAGCACAGACGACAAGAAACCAGGGGAAAGAAAAATTAAGAGGCATGCTAAAAATAA TTGAGGTTTTCATGATTCAGCACCTGCTTTTGTTTCTGTGAGATGAGCTAAATTGCTTTC ATACCCCAGATAAGAGCTAAAACCACCTAATGCTCTTATGGCACAGCTGTGTATAGATTT AGTTCTCTTTATACTTCATTTCTAGCCCAGTTGGGTTTTGATTTATATAAGTAGTTTAGA CCTTCTCTTCATAATCTTGCTCTGAGATGGGGAACAGAACACACAAGTATGAAGTTTCTT TCAGGTGTAAATAATGAAAAATAAATGCCTCATAAATGATAGTACAATGTAACTATCAAA GTTTTATAATTCATTATGAGTTAACCATTTTAATGTTTCCAATTAAACCTCATAGTGCAA GTAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_014041 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014041.2, NP_054760.2 |
| RefSeq Size | 1100 bp |
| RefSeq ORF | 309 bp |
| Locus ID | 28972 |
| UniProt ID | Q9Y6A9 |
| Protein Families | Protease, Transmembrane |
| Gene Summary | Component of the microsomal signal peptidase complex which removes signal peptides from nascent proteins as they are translocated into the lumen of the endoplasmic reticulum.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201472 | SPCS1 (Myc-DDK-tagged)-Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1) |
CNY 1200.00 |
|
| RC201472L3 | Lenti ORF clone of Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201472L4 | Lenti ORF clone of Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1), mGFP tagged |
CNY 5890.00 |
|
| RG201472 | SPCS1 (tGFP-tagged) - Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1) |
CNY 2800.00 |
|
| SC115189 | SPCS1 (untagged)-Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1) |
CNY 1200.00 |
|
| SC327744 | SPCS1 (untagged)-Human signal peptidase complex subunit 1 homolog (S. cerevisiae) (SPCS1) |
CNY 3990.00 |
