CTRP4 (C1QTNF4) (NM_031909) Human Untagged Clone
CAT#: SC322667
C1QTNF4 (untagged)-Human C1q and tumor necrosis factor related protein 4 (C1QTNF4)
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CTRP4; ZACRP4 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322667
TCGCGGGCTCAGACCGAACCCGACTCGACCGCCGCCCCCAGCCAGGCGCCATGCTGCCGC
TTCTGCTGGGCCTGCTGGGCCCAGCGGCCTGCTGGGCCCTGGGCCCGACCCCCGGCCCGG GATCCTCTGAGCTGCGCTCGGCCTTCTCGGCGGCACGCACCACCCCCCTGGAGGGCACGT CGGAGATGGCGGTGACCTTCGACAAGGTGTACGTGAACATCGGGGGCGACTTCGATGTGG CCACCGGCCAGTTTCGCTGCCGCGTGCCCGGCGCCTACTTCTTCTCCTTCACGGCTGGCA AGGCCCCGCACAAGAGCCTGTCGGTGATGCTGGTGCGAAACCGCGACGAGGTGCAGGCGC TGGCCTTCGACGAGCAGCGGCGGCCAGGCGCGCGGCGCGCAGCCAGCCAGAGCGCCATGC TGCAGCTCGACTACGGCGACACAGTGTGGCTGCGGCTGCATGGCGCCCCGCAGTACGCGC TAGGCGCGCCCGGCGCCACCTTCAGCGGCTACCTAGTCTACGCCGACGCCGACGCTGACG CGCCTGCGCGCGGGCCGCCCGCGCCCCCCGAGCCGCGCTCGGCCTTCTCGGCGGCGCGCA CGCGCAGCTTGGTGGGCTCGGACGCTGGCCCCGGGCCGCGGCACCAACCACTCGCCTTCG ACACCGAGTTCGTCAACATTGGCGGCGACTTCGACGCGGCGGCCGGCGTGTTCCGCTGCC GTCTGCCCGGCGCCTACTTCTTCTCCTTCACGCTGGGCAAGCTGCCGCGTAAGACGCTGT CGGTTAAGCTGATGAAGAACCGCGACGAGGTGCAGGCCATGATTTACGACGACGGCGCGT CGCGGCGCCGCGAGATGCAGAGCCAGAGCGTGATGCTGGCCCTGCGGCGCGGCGACGCCG TCTGGCTGCTCAGCCACGACCACGACGGCTACGGCGCCTACAGCAACCACGGCAAGTACA TCACCTTCTCCGGCTTCCTGGTGTACCCCGACCTCGCCCCCGCCGCCCCGCCGGGCCTCG GGGCCTCGGAGCTACTGTGAGCCCCGGGCCAGAGAAGAGCCCGGGAGGGCCAGGGGCGTG CATGCCAGGCCGGGCCCGAGGCTCGAAAGTCCCGCGCGAGCGCCACGGCCTCCGGGCGCG CCTGGACTCTGCCAATAAAGCGGAAAGCGGGCACGCGCAGCGCCCGGCAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_031909 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_031909.1, NP_114115.1 |
RefSeq Size | 1393 bp |
RefSeq ORF | 990 bp |
Locus ID | 114900 |
UniProt ID | Q9BXJ3 |
Domains | C1Q |
Protein Families | Secreted Protein |
Gene Summary | May be involved in the regulation of the inflammatory network. Its role as pro- or anti-inflammatory seems to be context dependent (PubMed:21658842, PubMed:27086950). Seems to have some role in regulating food intake and energy balance when administered in the brain. This effect is sustained over a two-day period, and it is accompanied by decreased expression of orexigenic neuropeptides in the hypothalamus 3 h post-injection (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207458 | C1QTNF4 (Myc-DDK-tagged)-Human C1q and tumor necrosis factor related protein 4 (C1QTNF4) |
CNY 2400.00 |
|
RC207458L1 | Lenti ORF clone of Human C1q and tumor necrosis factor related protein 4 (C1QTNF4), Myc-DDK-tagged |
CNY 4800.00 |
|
RC207458L2 | Lenti ORF clone of Human C1q and tumor necrosis factor related protein 4 (C1QTNF4), mGFP tagged |
CNY 5890.00 |
|
RC207458L3 | Lenti ORF clone of Human C1q and tumor necrosis factor related protein 4 (C1QTNF4), Myc-DDK-tagged |
CNY 5890.00 |
|
RC207458L4 | Lenti ORF clone of Human C1q and tumor necrosis factor related protein 4 (C1QTNF4), mGFP tagged |
CNY 5890.00 |
|
RG207458 | C1QTNF4 (tGFP-tagged) - Human C1q and tumor necrosis factor related protein 4 (C1QTNF4) |
CNY 4370.00 |
|
SC106847 | C1QTNF4 (untagged)-Human C1q and tumor necrosis factor related protein 4 (C1QTNF4) |
CNY 2400.00 |