Prokineticin 2 (PROK2) (NM_001126128) Human Untagged Clone
CAT#: SC322834
PROK2 (untagged)-Human prokineticin 2 (PROK2), transcript variant 1
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BV8; HH4; KAL4; MIT1; PK2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322834 representing NM_001126128.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGAGCCTGTGCTGCGCCCCACTCCTGCTCCTCTTGCTGCTGCCGCCGCTGCTGCTCACGCCCCGC GCTGGGGACGCCGCCGTGATCACCGGGGCTTGTGACAAGGACTCCCAATGTGGTGGAGGCATGTGCTGT GCTGTCAGTATCTGGGTCAAGAGCATAAGGATTTGCACACCTATGGGCAAACTGGGAGACAGCTGCCAT CCACTGACTCGTAAAAACAATTTTGGAAATGGAAGGCAGGAAAGAAGAAAGAGGAAGAGAAGCAAAAGG AAAAAGGAGGTTCCATTTTTTGGGCGGAGGATGCATCACACTTGCCCATGTCTGCCAGGCTTGGCCTGT TTACGGACTTCATTTAACCGATTTATTTGTTTAGCCCAAAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001126128 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001126128.1 |
RefSeq Size | 1613 bp |
RefSeq ORF | 390 bp |
Locus ID | 60675 |
UniProt ID | Q9HC23 |
Protein Families | Druggable Genome, Secreted Protein |
MW | 14.3 kDa |
Gene Summary | This gene encodes a protein expressed in the suprachiasmatic nucleus (SCN) circadian clock that may function as the output component of the circadian clock. The secreted form of the encoded protein may also serve as a chemoattractant for neuronal precursor cells in the olfactory bulb. Proteins from other vertebrates which are similar to this gene product were isolated based on homology to snake venom and secretions from frog skin, and have been shown to have diverse functions. Mutations in this gene are associated with Kallmann syndrome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225090 | PROK2 (Myc-DDK-tagged)-Human prokineticin 2 (PROK2), transcript variant 1 |
CNY 3990.00 |
|
RC225090L3 | Lenti-ORF clone of PROK2 (Myc-DDK-tagged)-Human prokineticin 2 (PROK2), transcript variant 1 |
CNY 5890.00 |
|
RC225090L4 | Lenti-ORF clone of PROK2 (mGFP-tagged)-Human prokineticin 2 (PROK2), transcript variant 1 |
CNY 5890.00 |
|
RG225090 | PROK2 (tGFP-tagged) - Human prokineticin 2 (PROK2), transcript variant 1 |
CNY 2920.00 |
其它Prokineticin 2产品